Скачать презентацию Unorthodox mitochondrial genomes Gertraud Burger Robert-Cedergren Center for Скачать презентацию Unorthodox mitochondrial genomes Gertraud Burger Robert-Cedergren Center for

ef2b78476982c56115352e2a9cc65fda.ppt

  • Количество слайдов: 38

Unorthodox mitochondrial genomes Gertraud Burger Robert-Cedergren Center for Bioinformatics and Genomics Université de Montreal Unorthodox mitochondrial genomes Gertraud Burger Robert-Cedergren Center for Bioinformatics and Genomics Université de Montreal QC, Canada 1

Background & overview Information flow in living cells replication transcription translation Post-transcriptional processes § Background & overview Information flow in living cells replication transcription translation Post-transcriptional processes § key role in gene regulation § processing of transcript ends § RNA splicing § RNA editing Topic Unique splicing & editing processes – in mitochondria. 2

Outline of the talk § Current knowledge of mt. DNAs across eukaryotes § Our Outline of the talk § Current knowledge of mt. DNAs across eukaryotes § Our study in a eukaryotic microbe § Evolutionary implications. 3

Who did the work Shona Teijeiro Yifei Yan Georgette Kiethega 4 Who did the work Shona Teijeiro Yifei Yan Georgette Kiethega 4

Mitochondrial-DNA encoded genes Genes involved in § Electron transport § ATP synthesis § Protein Mitochondrial-DNA encoded genes Genes involved in § Electron transport § ATP synthesis § Protein synthesis § r. RNAs § t. RNAs § riboproteins § RNA processing § RNase P § Protein import, assembly & maturation § Transcription Orange, always mt. DNA-encoded; pink, variably mt. DNA-encoded. Blue, nuc. DNA-encoded. cytochrome c oxidase subunit 1 (cox 1). 5 Review: Burger et al 2003 Trends Genet 19: 709

Typical mt. DNAs and deviations Chromosome number § one to >100 Size § 6 Typical mt. DNAs and deviations Chromosome number § one to >100 Size § 6 kbp - 50 kbp - 4, 100 kbp Shape § circular-mapping linear § linear monomeric § truly circular. 6 Lang et al 1999 Annu Rev Genet 33: 351

All but typical: mt. DNAs of kinetoplastids you are here 7 Keeling PJ, Burger All but typical: mt. DNAs of kinetoplastids you are here 7 Keeling PJ, Burger G et al 2005 Trends Ecol Evol 20: 670

All but typical: mt. DNAs of kinetoplastids Diplonemids Kinetoplastids Euglenids Plantae Rhizaria Fungi Metazoa All but typical: mt. DNAs of kinetoplastids Diplonemids Kinetoplastids Euglenids Plantae Rhizaria Fungi Metazoa Stramenopiles Jakobids 8 Simpson & Roger 2004 Mol Phylogenet Evol 30: 201

What we know about kinetoplastid mt. DNAs § Complete genome sequences § Multiple chromosomes What we know about kinetoplastid mt. DNAs § Complete genome sequences § Multiple chromosomes § Cryptic genes § RNA editing Diplonemids Kinetoplastids Euglenids Plantae Rhizaria Fungi Metazoa Stramenopiles Jakobids 9 Review: Lukes et al 2002 Euk Cell 1: 425

Kinetoplastid U-insertion/deletion RNA editing gene sequence AGTCAAGTGTCACGACTCCAGTGTCC transcription prim. transcript AGUCAAGUGUCACGACUCCAGUGUCC U deletions mature Kinetoplastid U-insertion/deletion RNA editing gene sequence AGTCAAGTGTCACGACTCCAGTGTCC transcription prim. transcript AGUCAAGUGUCACGACUCCAGUGUCC U deletions mature m. RNA ^ ^ ^ U insertions AGUCAAGUG. CAUCGAUC. CUUCAGUGUCC editosome AGUCAAGUGUCACGACUCCAGUGUCC prim. transcript guide RNA GGUUUACGU CG UUC CAG A A AA Various distinct RNA editing mechanisms in eukaryotes, viruses 1. 10 Review: Stuart et al 2005 Trends Biochem Sci 39: 97; 1 Review: Gott & Emerson Annu Rev 34: 499

Little known about other euglenozoans’ mt. DNAs § Complete genomes § ~40 kbp (maxicircle) Little known about other euglenozoans’ mt. DNAs § Complete genomes § ~40 kbp (maxicircle) § Multiple minicircles § RNA editing Kinetoplastids § Partial cox 1 -m. RNA § Genome size? § Multiple circles? § cox 1, 2, rns § Genome size? § ∞ linear chromosomes? Euglenids Diplonemids Plantae Rhizaria Fungi Metazoa Stramenopiles Jakobids 11 Lukes et al 2002 Euk Cell 1: 425; Maslov et al 1999 Protist 150: 33

Our initial questions Are kinetoplastids the only Euglenozoa with unconventional mt. DNA and RNA Our initial questions Are kinetoplastids the only Euglenozoa with unconventional mt. DNA and RNA editing? When did these unusual features emerge? . 12

Our approach Study sistergroup of kinetoplastids: diplonemids § § mt. DNA genome sequencing electron Our approach Study sistergroup of kinetoplastids: diplonemids § § mt. DNA genome sequencing electron microscopy transcript studies bioinformatics Kinetoplastids Species § § D. papillatum D. ambulator Rhynchopus euleeides Diplonema papillatum Diplonema ambulator Diplonema sp. 2 Rhynchopus euleeides. Rhynchopus Roy et al. 2007, Eukaryot Microbiol 54: 137; Roy et al Protist 158: 385 Diplonema sp. 2 Euglenids Diplonemids plants fungi animals Diplonema 13

Unusual mt-genome architecture in Diplonema >100 circular molecules of two size classes § A-class Unusual mt-genome architecture in Diplonema >100 circular molecules of two size classes § A-class chromosomes (6 kbp) § B-class chromosomes (7 kbp) Topology : Relaxed circles. A B 14 Marande et al 2007 Eukaryot Cell 4: 1137

Unusual mitochondrial chromosomes Sequence of class A and class B chromosomes (Diplonema) § constant Unusual mitochondrial chromosomes Sequence of class A and class B chromosomes (Diplonema) § constant region 95% (common to A+B: 35%; class-specific 60%) § unique cassette (5%). constant region A-class (6 kbp) B-class (7 kbp) cassette 15

Unusual mitochondrial chromosomes cont’d Sequence of size class A (6 kbp) and B (7 Unusual mitochondrial chromosomes cont’d Sequence of size class A (6 kbp) and B (7 kbp) (Diplonema) § constant region 95% (common to A, B: 35%, class-specific 60%) § unique cassette (5%) Each cassette includes § single gene module (60 -280 bp) § flanking regions (10 -120 bp). cassette gene module flanking regions 16

Summary 1: Diplonema mt. DNA Unusual genome architecture § ~100 chromosomes with different gene Summary 1: Diplonema mt. DNA Unusual genome architecture § ~100 chromosomes with different gene modules ~650 kbp the least compact mt. DNA known. 17

What is the exact mt-gene structure? How are genes expressed in Diplonema mt. DNA? What is the exact mt-gene structure? How are genes expressed in Diplonema mt. DNA? m#1 m#2 m#3 m#4 gene module (coding) 18

Modular structure of Diplonema cox 1 gene is split up into 9 modules a Modular structure of Diplonema cox 1 gene is split up into 9 modules a single module per chromosome 7 modules on A-class chromosomes 2 modules on B-class chromosomes. m 1 B m 1 A m 6 B m 4 A m 2 m 3 m 5 A m 4 m 5 A m 8 m 7 A m 6 m 7 m 9 A m 8 m 9 c. DNA 19

All Diplonema mt-genes are fragmented Gene ~250 kbp sequenced: >11 standard genes § 4 All Diplonema mt-genes are fragmented Gene ~250 kbp sequenced: >11 standard genes § 4 - 10 modules per gene § No t. RNA genes § Gene set ~ kinetoplastids. atp 6 cob cox 1 cox 2 cox 3 nad 1 nad 4 nad 5 nad 7 nad 8 nad 9 rns rnl Diplonema # modules + + + + + ? ? + 4 6 9 4 4 >1 >3 10 9 ~3 ? ? >1 Trypanosomes + + + + 20

How are modular genes expressed? Gene pieces joined at transcript level, because § no How are modular genes expressed? Gene pieces joined at transcript level, because § no contiguous gene copy in Diplonema total DNA § but contiguous c. DNA. m. RNA protein 21

Module concatenation at RNA level Evidence from various experiments (cox 1) § Northern hybridization Module concatenation at RNA level Evidence from various experiments (cox 1) § Northern hybridization Single-module transcripts § c. DNA library screening Precise end processing § RNA ligation experiments Concatenation intermediates Trans-splicing. m 1 m 2 ~700 m 1 m 2 m 3 m 4 m 5 6 m 7 m 8 m 9 AAAAA m 9 m 9 3’-OH m 3 m 4 m 5 6 m 7 m 8 5’-P? m 9 AAAAA 22 Known trans-splicing in nucleus & organelles: discontinuous spliceosomal, group I, II, t. RNA-introns 1. Marande & Burger 2007 Science 318: 415; 1 Review: Bonen (1991) Faseb J 7: 40 -46

Strictly ordered module assembly All transcripts have modules in correct order How? By pairing Strictly ordered module assembly All transcripts have modules in correct order How? By pairing of. . § flanking regions of ‘neighbor’ cassettes? § modules of ‘neighbor’ cassettes? § flanking region of one with module region of other? HBH motif 23

Can neighbors pair? No signal. Sequence complementarity between neighboring modules or flanking regions m Can neighbors pair? No signal. Sequence complementarity between neighboring modules or flanking regions m 1 m 2 m 3 m 4 m 5 m 6 m 7 m 8 m 9 24 tool: dotter

Residues conserved across cassettes? No. upstream flanking cassette module downstream-flanking . . m 1. Residues conserved across cassettes? No. upstream flanking cassette module downstream-flanking . . m 1. . TACGACGaggactgcgcat…. . . gatgagtagcag. CATGGCA. . m 2. . GTCGGGActcacccacgca…. . . ctgtcatcgtag. CATGGCT. . m 3. . CGTGGCAtccatac…. . . atggtatgtggt. ATCACAG. . m 4. . GGAGGACcggacactacac. . . cttggcatccac. CGCTCTA. . m 5. . GATGGTGtgtgggtgctcc…. . . taggtagcattg. GGACTTG. . m 6. . CTCTCATgcagcccgcgct…. . . atggagtcatcg. TAGGAGC. . m 7. . CCGTGTActgctacgtggt…. . . accagtgtgact. CAGGTGG. . m 8. . ACCTAGGtatctgtgctct…. . . gtacagc. TACAGTG. . m 9. . END START m 1 m 2 m 3 m 4 m 5 6 m 7 m 8 m 9 25

Comparative analysis across diplonemids § § cox 1 fragmented in all species? Yes Module Comparative analysis across diplonemids § § cox 1 fragmented in all species? Yes Module boundaries identical? Most, +/- 1 nt Are there motifs shared by all diplonemids? No Do junctions coincide with known intron insertion sites? No. D. papillatum D. ambulator D. sp. 2 Rhynchopus D. p. D. a. D. s. R. e. . . . cgacgcatgg ccagtcatgc catcacatgc ctagtcatgc . . . v. . . D. p. D. a. D. s. R. e. . . v. . . cgggacatgg gggagcatga cggtatatga cggagcagca . . . D. p. D. a. D. s. R. e. gtgtacaggt gtatgcagtt gtatgcaagt 26

Summary 2: Unknown type of trans-splicing In silico searches in Diplonema mt. DNA ‘external’ Summary 2: Unknown type of trans-splicing In silico searches in Diplonema mt. DNA ‘external’ information… m 1 m 2 § No complementarity between neighbor modules or flanking regions § No conserved residues at module boundaries § No sequence or 2 D-motifs typical for § Group I, II § spliceosomal introns § t. RNA introns m 1 GU m 2 AG m 2 27 Review on known types of trans-splicing: Bonen (1991) Faseb J 7: 40 -46

Unknown type of trans-splicing cont’d ‘External information’ for ordered module joining § proteins? § Unknown type of trans-splicing cont’d ‘External information’ for ordered module joining § proteins? § RNAs? . 28

Further unusual post-transcriptional event cox 1 chromosomes m 3 transcription. . processing. . m Further unusual post-transcriptional event cox 1 chromosomes m 3 transcription. . processing. . m 4 m 5 m 6 m 3 m 4 m 5 m 6 …. …. concatenation. . …. m. RNA 29

Further unusual post-transcriptional event cox 1 chromosomes m 3 transcription. . processing. . m Further unusual post-transcriptional event cox 1 chromosomes m 3 transcription. . processing. . m 4 m 5 m 6 m 3 m 4 m 5 m 6 …. …. concatenation insertion editing (rare) . . UUUUUU …. m. RNA 30

How does editing proceed? • After module ligation? • Before module ligation No No How does editing proceed? • After module ligation? • Before module ligation No No • U-addition at 5’-end of ‘left’ module? • U-addition at 3’-end of ‘right’ module? Yes. m 4 uuu + uuu m 5 m 4 + m 5 m 4 UUUUUU … m 4 UUUUUU m 5 … m 1 m 2 m 3 m 4 UUUUUU m 5 6 m 7 m 8 m 9 31

Mechanism of post-transcriptional processes Hypothesis: three in one We postulate that in diplonemids guide Mechanism of post-transcriptional processes Hypothesis: three in one We postulate that in diplonemids guide RNA-like molecules § direct transcript-end processing § align adjacent gene modules § template RNA editing. m 1 : : : XXXXXXX GAGAAA m 4 : : : m 1 m 4 UUUUUU : : : : GAGAAA m 2 : : : m 4 UUUUUU m 5 : : : : : GAGAAA 32

Editing/trans-splicing biochemistry § Editing proceeds by U-addition at 3’-end of ‘left’ module § may Editing/trans-splicing biochemistry § Editing proceeds by U-addition at 3’-end of ‘left’ module § may involve TUTase and endonuclease. hypothetical TUTase m 4 UUUUUU -OH : : : : : XXXXXXX m 4 GAGAAA -OH ? hypothetical endonuclease leaving 3’ P m 4 UUUUUU -OH : : : : : XXXXXXX GAGAAA m 4 UUUUUU -P : : : : GAGAAA 3’ phosphatase ligase m 4 UUUUUU m 5 : : : : : GAGAAA 33

Work in progress to validate hypotheses 1. Search for g. RNAs in Diplonema p. Work in progress to validate hypotheses 1. Search for g. RNAs in Diplonema p. (cox 1) § in silico search in mt. DNA m 1 m 2 : : : § found candidates for 5 out of 8 junctions 6 0 6 § experimental RT-PCR search in RNA § found candidate for § module 5 5’processing & trans-splicing § module 2 -3 trans-splicing. m 2 m 3 PCR-primer 5’ 3’ RT-primer PCR-primer m 5 xxxxxx: : : GAGAAA m 4 UUUUUU m 5 : : : GAGAAA product 34

Work in progress cont’d 1. Search for g. RNAs in Diplonema papillatum (cox 1) Work in progress cont’d 1. Search for g. RNAs in Diplonema papillatum (cox 1) § in silico search in mt. DNA § experimental RT-PCR search in RNA 2. Compare cox 1 across diplonemids § search for conserved 2 D-structure (RNAshapes) 3. Develop in vitro system for validation. 35 Steffen et al 2006 Bioinformatics 22: 500

Summary & Outlook In diplonemids, we discovered 1. mitochondrial genome with >100 chromosomes 2. Summary & Outlook In diplonemids, we discovered 1. mitochondrial genome with >100 chromosomes 2. fragmented mt-genes, 1 module per chromosome trans-splicing + rare U-insertion RNA editing machinery may resemble kinetoplastids’ editosome 3. molecular mechanisms being investigated experimentally and in silico. prim. transcript AGUGAAGAGGACGACUCCAAUGUAA. . . . XX: : : : guide RNA UUUUU CGUGAGGU AA cut [add] prim. transcripts re-ligate AGUCAAGUGUA XXCGACUCCAGUGUCC : : : : hypoth. guide RNA GGUUUACGU CGUGAG AA kinetoplastids diplonemids? cut add re-ligate 36

Final speculations Unnecessarily complicated gene organization and expression - Advantage? - Disadvantage? - evolution Final speculations Unnecessarily complicated gene organization and expression - Advantage? - Disadvantage? - evolution under superabundant conditions. 37

Collaborations & funding Julius Lukes, University of South Bohemia, Czech Republic M. W. Gray Collaborations & funding Julius Lukes, University of South Bohemia, Czech Republic M. W. Gray & M. Schnare, Dalhousie University, Halifax, Canada B. Franz Lang, Université de Montréal, Canada. 38