The ASAS Genomics Centre DNA Sequencing Facility Sanger

The ASAS Genomics Centre DNA Sequencing Facility Sanger Sequencing & Troubleshooting By Kristine Boxen ASAS monthly seminars 15 July 2015

DNA Sequencing Facility Sanger Sequencing & Troubleshooting 15 July 2015 Kristine Boxen

Automated DNA Sanger sequencing • • Classic technology Developed in the 1970’s by Frederick Sanger An important tool in molecular biology We use a slight variation of the original method called chain-termination • DNA samples are sent to the Centre for processing • Controls are run with every tray and pre checked on a Nanodrop • Chemical reactions called “cycle sequencing” performed on a thermal cycler 9700 using Big. Dye Terminator v 3. 1 kits

Automated DNA Sanger sequencing • Incorporation of four fluorescent dyes that bind specifically to the four nucleotides • DNA nucleotides A, C, G, T (adenine, cytosine, guanine and thymine) • Thousands of copies are produced that are different lengths • Samples purified using magnetic bead technology • Samples sequenced on a 3130 XL Genetic Analyzer • DNA products separated by size (like agarose gel electrophoresis)

Nano. Drop spectrophotometer Check samples on a Nanodrop first to measure: 1. Purity 2. Concentration Can accurately measure tiny volumes of sample as low as 1 μl. 4

Big. Dye Terminator (DT) chemistry dd. ATP dd. CTP dd. GTP dd. TTP AGCCTCAG A AGCCTC AGCCT AGCC AG A • Samples and primer are mixed with Big. Dye (enzyme, buffer, and nucleotides) We can do this for you, or you can do it yourself • DTs are performed in a single tube making this the method of choice • We use version 3. 1 kits from Thermo. Fisher Scientific 5

Gene. Amp PCR System 9700 • Cycle sequencing is linear amplification • Only one primer per reaction • Uses 50 °C annealing temperature • Primer melting temperature (TM) important Big. Dye 6 Diagram from http: //www. appliedbiosystems. com/absite

ABI PRISM™ 3130 XL DNA Genetic Analyzer • The 3130 XL is a workhorse! • Processes 192 samples per 24 hours • Produces up to 192, 000 bases of sequence daily • Accuracy is approx 98% 7

ABI PRISM™ 3130 XL DNA Genetic Analyzer A look inside the 3130 XL! Capillaries are Teflon-coated glass tubes and contain liquid polymer for separation (Replacing older-style slab polyacrylamide gels)

Detection system AGCT Deoxy nucleotides Dideoxy nucleotides - Primer AGTTCGTAGTCAAATGCAT AGTTCGTAGTCAAATGCA AGTTCGTAGTCAAATGC AGTTCGTAGTCAAATG AGTTCGTAGTCAAAT AGTTCGTAGTCAAA AGTTCGTAGTCA AGTTCGTAGTC AGTTCGTAGT ARGON LASER . . . TCAAGCATCAGTTTACGTAAGCT. . T C A A A T G Filter Wheel + C CCD camera Template A T Four-dye, one-lane technology eliminates variability and increases sample throughput. 9

Capillary image • The image above is a reconstruction or gel image of the data collected. • DNA fragments are separated by size. • The side picture shows a portion of the gel image enlarged where you can observe individual bases.

Data output Data in electropherogram format shows peaks. abi file Free software sequence scanner v 1. 0 (Life Tech). Data in sequence file format shows text. seq file

Recommendations for successful sequencing Good quality sequence data, with sharp peaks, no N’s and high quality value scores * Check sample using a Nanodrop. Check for contaminants. * Check the primer melting temperature. Use a software programme eg Primer Express. * Submit samples at the correct concentrations. Use water not EDTA or TRIS. * Ask for us to add DMSO (dimethyl sulphate) if secondary structure problems. * For Ethanol ppte always use fresh stocks and ensure it is completely removed. Image from Applied Biosystems DNA Sequencing by Capillary Electrophoresis; 2 nd Edition, section 8 Troubleshooting

Troubleshooting Contaminants such as excess salt, RNA or protein in your sample: These cause the bands to be distorted and wide and the quality scores are low. The software has problems calling the right bases. A failed reaction: There are many Ns called as the reaction has failed due to template and/or primer problems with high background noise observed. The software cannot call the correct bases. Images from Applied Biosystems DNA Sequencing by Capillary Electrophoresis; 2 nd Edition, section 8 Troubleshooting

Troubleshooting – too much salt Effect of too much residual salt Across the gel image the sequence gradually deteriorates with increasing amounts of sodium chloride, Na. Cl. Lane 1 no added salt Lanes 2 -11 salt added in 10 m. M increments from 10 -100 m. M. Image from ABI Automated DNA Sequencing Chemistry Guide: Data Evaluation and troubleshooting 7 -3

Troubleshooting – too much ethanol Effect of too much residual ethanol Excess dye blobs are seen in samples in lane 1 & 2 with incomplete removal of ethanol. Image from ABI Automated DNA Sequencing Chemistry Guide: Data Evaluation and troubleshooting 7 -3

Troubleshooting – traces of marker pen Effect of marker pen written on top of trays Always write your name on the side of 96 well trays as problems with leakage. Image from ABI Automated DNA Sequencing Chemistry Guide: Data Evaluation and troubleshooting 7 -3 12

Submitting your template Sample Requirements Please supply your templates as detailed below: My recommendation: Have your samples as close as possible to these concentrations. 12

Current Charges for Sanger Sequencing Service Customers Submit in Cost per sample Full service (we do the reaction) External Tubes or trays $20 Uo. A Tubes or trays $15 (1/4 Big. Dye) $10 (1/8 Big. Dye) Tubes $10 96 -well trays $5 $420 for 96 Electrophoresis Uo. A & only External (do your own Uo. A & reaction) External Book through i. Lab at https: //asas-centres. ilabsolutions. com/ My recommendation: For full service, 1/4 Big. Dye is the best option for plasmids. 12

Monthly prizes sponsored by Thermo. Fisher Scientific Every month we award a prize selected from the best sequencing samples and most improved samples submitted in a given month. Will you be next? 12

• TNGATTATCGTGAAAAACGAACCTAATAGCGGCT GCAGACCATTAGGATTTCCTGATCCAAATCGAGGT CGTAGAAACCCCTTTCGTTATGGCTAAAAAGGGGA TTGCGAGCTGTTATCCCTAGGGTAAACTCGGTCCG TTGATCGGCGTTGCCGGATCTTATTGGTCAGAATT TCTGTTAAGGAGCGGGAGCTCTAGGTTGTAG (09) 3737599 x 87293 ` GAAAAGTATCCCGTTCAAGGTGGGGTTTTGTATTC CCCGCGGTCGCCCCAAAGACATAGAGTAGG k. boxen@auckland. ac. nz GTTATAGGGGTTTTAACTTGAGGGCTACTTTGGTG TCTAAAGTTCTTAGGGTATCGTTATGGCTAAAAAG GGGATTGCGAGCTGTTATCCCTAGGGTAAACTCG Special thanks to Thermo. Fisher Scientific for sponsorship of monthly prizes and use of images. GTCCGTTGATCGGCGTTGCCGGATCTTATTGGTCA GAATTTCTGTTAAGGA Kristine Boxen