eefe2f1da202d4f4503324cc6125361b.ppt
- Количество слайдов: 1
SWACM 2009 EPIDEMIOLOGY OF INFLUENZA A VIRUS CIRCULATING IN KANSAS CITY: SUBTYPES AND RESISTANCE TO ANTIVIRAL DRUGS (2007 - 2009) Suresh B. Selvaraju and Rangaraj Selvarangan Children’s Mercy Hospitals and Clinics, Kansas City, MO 64108 Contact: sselvaraju@cmh. edu ABSTRACT Background: Influenza viruses are the major causative agents of human acute respiratory disease world-wide. This year CDC reported an increase in antiviral drug resistance to oseltamivir among H 1 N 1 strains. Further, H 3 N 2 strains retained resistance to adamantanes. The alarming increase in drug resistance among evolving subtypes of influenza A viruses warrant regional investigation on epidemiology of these resistant strains. Aim: The aim of this study was to investigate the oseltamivir and adamantane resistance among H 1 and H 3 strains of influenza viruses in Kansas City during three subsequent years, 2007 to 2009. Methods: A total of 450 Respiratory specimens positive for Influenza A antigen (150 each year, ) by rapid antigen test were used for this study. RNA was extracted, c. DNA was prepared and tested on ABI 7500 real-time PCR system. Influenza A positive specimens were sub-typed as A/H 1 or A/H 3 types by Taqman-based realtime PCR. Influenza A/H 1 and A/H 3 strains were tested for their susceptibility to Oseltamivir (H 274 Y mutation) and adamantanes (S 31 N mutation) using genotyping assays. Results: The influenza A H 1/H 3 typing results showed that H 1 type was predominant during the 2007 (n=74; 49. 3%) and 2009 (n=119; 79. 3%) seasons when H 3 type dominated the 2008 (n=82; 54. 7%) season. The Oseltamivir resistance (H 274 Y) in the A/H 1 type was 100% (113/113) for 2009 strains, which is similar to the 99. 8% of nationwide surveillance report by the CDC. Interestingly, only 0. 3% (n=1/32) of neuraminidase inhibitor resistance was observed during 2008 season when CDC reported about 10. 9%. During 2007 season 100% oseltamivir susceptibility (n=69/69) was observed among A/H 1 strains. Adamantane resistance was 100% (n=2/2) among 2007 A/H 3 strains and 94% (77/82) during 2008 season. One A/H 3 strain was typed during 2009 season and it was susceptible to adamantanes. Conclusions: Our regional antiviral surveillance study helped in understanding the epidemiology of drug resistance among influenza viruses in Kansas City area. The simple and rapid real-time PCR-based methods validated for typing influenza A H 1/H 3 strains and for detection of both oseltamivir (H 274 Y mutation) and adamantane (S 31 N) resistance will be useful for routine monitoring of antiviral resistance in clinical laboratories. The demographic and clinical data of patients infected with antiviral drug resistant and susceptible influenza A viruses are being reviewed. MATERIALS AND METHODS Specimens. A total of 450 (150 each year) specimens that were characterized by rapid antigen tests as positive for influenza A strains were selected for this study. Controls. The oseltamivir resistant and susceptible reference strains, A/New Jersey/15/07 (H 1 N 1) and A/California/27/07(H 1 N 1), respectively, were obtained from Dr. Larisa V. Gubareva, CDC, Atlanta. These reference strains were included as positive and negative controls in real-time PCR experiments. Influenza A-H 1/H 3 typing. Nucleic acid was extracted from 200 µl of specimen by using either Nucli. SENS easy. MAG (bio. Merieux Inc. , Durham, NC) automated extraction or Quick. Gene-Mini 80 (Auto. Gen, Holliston, MA) semi-automated extraction systems. c. DNA was prepared using Taq. Man reverse transcription reagents as per the manufacturer’s recommendation (Applied Biosystems, Foster City, CA). Influenza A positive specimens were sub-typed for A/H 1 and A/H 3 types by Taqman probe-based real-time PCR using 7500 real-time PCR system as described earlier (Suwannakarn, et al. 2008) with a little modification in A/H 1 -specific forward primer (Table 1). H 274 Y and S 31 N mutation detection. All A/H 1 strains were tested for oseltamivir resistance (H 274 Y mutation) and A/H 3 strains were tested for adamantane resistance (S 31 N mutation). Genotyping-based real-time PCR reactions were performed using two oligonucleotide probes with single-base variation for resistant and susceptible strains, respectively, as described by Carr, et al. 2008 and Cheng, et al. 2009. The primers and probes sequences used for this study are given in Table 1. A PCR reaction Sequences CONCLUSIONS References A/H 1 -A/H 3 typing Flu. A-H 1 -F 5’-AYTACTGGACYYTGCTDRAA -3’ Flu. A-H 1 -R 5’-AAGCCTCTACTCAGTGCGAA-3’ Flu-H 1 -P 5’-FAM-TTGAGGCAAATGGAAATCTAATAGC ’-BHQ-1 -3 This study and Suwannakarn, et al. 2008 OR-Genotyping 5’-CCGCCTCGTACAAAATCTTCAAGA-3’ Flu. AN 1 -H 275 Y-R 5’-CAGTGTCTGGGTAACAGGAACATT-3’ Flu. AN 1 -H 275 Y-OR Influenza viruses are classified into types A, B and C, based on antigenic differences in their nucleoprotein (NP) and matrix (M) protein. Influenza viruses A and B are the major causative agents of human acute respiratory disease worldwide. Infants, elderly persons, and individuals with compromised cardiac, pulmonary, or immune function are at the greatest risk of serious complications from these viruses. Most influenza pandemics are associated with type A which represents the most widespread human pathogen. Influenza A viruses can be classified further into subtypes H 1 N 1 and H 3 N 2 based on the antigenic variations. Adamantane derivatives (amantadine and rimantadine) and oseltamivir were recommended drugs for antiviral treatment however, adamantanes were not preferred now due to the high proportion of resistance among all circulating strains (Bright et al. 2005). Later, oseltamivir is used widely as an antiviral drug for influenza that potentially inhibit neuraminidase (NA) protein of influenza virus (Kim et al. 1997). Until recently, oseltamivir resistance occurred in <1% of circulating viruses globally. An increased number of influenza A viruses (H 1 N 1) with resistance to oseltamivir was first reported by Norway in 2008. The viruses carried specific Histidine-to-Tyrosine mutation at position 274 in the NA protein that confers resistance to oseltamivir (Lackenby et al. 2008). Most recently, CDC has observed an increase (98% in 2009 as compared to 10. 9% in 2008) in oseltamivir antiviral drug resistance among H 1 N 1 strains of influenza virus in the USA. Further, these oseltamivir resistant strains reverted to being adamantine susceptible, while the H 3 N 2 strains retain adamantine resistance and oseltamivir susceptibility. The alarming increase and diversity in drug resistance among evolving strains of influenza A viruses warrants careful investigation on epidemiology of these resistant strains. Drug resistance Oseltamivir Adamanta (A/H 1 nes (A/H 3 Yea strains) r Kans Kan as sas City CDC 4/588 2/2 Not 200 0/74 (0. 7% (100 avail 7 (0%) ) %) able 4. New York (NY) and Wisconsin (WI) regional surveillance study 77/8 524/5 1/32 111/1 A/H 1 -H 3 typing 2 25 Drug resistance 200 (3. 1 020 (94 (99. 8 A/H 1 A/H 3 Oseltamivir (H 1 N 1) Adamantanes (H 3 N 2) 8 %) (10. 9) %) %) Year NY (2001 – 113/1 NY 1141/ WI 245/2 NY WI WI ‘ 07) 13 1146 45 200638/42 29/39 0/18 Not 30/35 Not 200 (100 0/37 (99. 6 0/107 (100 0/2 (0%) (90. 5%) (74. 4%) (0%) available (85. 7%) available 9’ 07 %) (0%) %) 20070/44 1/42 101/101 44/44 5/45 8/46 Not ’ 08 (0%) (2. 4%) (100%) (11. 1%) (17. 4%) available 1. Primers and probes sequences used in this study* Flu. AN 1 -H 275 Y-F INTRODUCTION 3. Number of A/H 1 -A/H 3 strains typed for three subsequent years 5’-FAM-CCTCATAATAAAAATTG-MGBNFQ-3’ Flu. AN 1 -H 275 Y-OS Carr, et al. 2008 5’-VIC-CTCATAATGAAAATTG-MGBNFQ-3’ S 31 N-Genotyping H 3 DR-F 5’- TGCAGATGCAACGATTCAAGTG -3’ H 3 DR-R 5’- AAAAGACGATCAAGAATCCACAATATCA -3’ H 3 -31 N-P 5’-FAM-CCGCGAATATCATTGGGA-MGBNFQ-3’ H 3 -31 S-P 5’-VIC-CCGCGAGTATCATTGGGA- MGBNFQ-3’ Cheng, et al. 2009 § During 2006 -07 season A/H 1 type was predominant (50%) in our region which agreed with CDC annual report (62%). Interestingly, A/H 3 strain was predominant type in NY (90%) and WI (74%) regions. Both regions did not observe any A/H 1 type during that season. § During 2007 -08 season 54. 7% of typed strains were A/H 3 strain in our region and it is lower than CDC report (74%). However, NY and WI region observed 100% of A/H 3 strains in their population when A/H 1 was only 2. 4%. In our region 21% of types strains were A/H 1 and it is similar to CDC report of 26%. In 2008 -09, A/H 1 population was predominant before novel H 1 N 1 s were reported in the USA. § All A/H 1 strains were susceptible or showed very less level of resistance (0. 7%; CDC) to oseltamivir during 2007 season. All A/H 3 strains were resistant to adamantanes in KC (100%) and 85. 7% of strains were resistant in NY region. During 2008 season only 0. 3% (1/32) of oseltamivir-resistant A/H 1 was observed in KC region while CDC and NY region reported about 10 -11% and WI region showed 17%. During 2009 season, all A/H 1 strains have become resistant to oseltamivir in KC region and it is similar to CDC report. § The untypeable strains vary from 20% (n=30) in 2009 to 49% (n=74) in 2007. Similarly, in NY region 54. 5% of the influenza strains were untypeable. § The demographic and clinical data of patients infected with antiviral drug resistant and susceptible influenza A strains are being reviewed. RESULTS 2. Number of A/H 1 -A/H 3 strains typed for three subsequent years § The observed differences in both typing and antiviral drug resistance among circulating influenza strains encourage regional based studies for better understanding of epidemiology and drug resistance. A/H 1 -H 3 typing Year A/H 1 REFERENCES A/H 3 2007 2008 2009 74/150 (49. 3%) 32/150 (21. 3%) 119/150 (79. 3%) CDC 3912 (62. 3%) 2175 (26%) 334 (21. 3%) Kansas City 2/150 (1. 3%) 82/150 (54. 7%) 2/150 (1. 3%) CDC 2368 (37. 7%) 6115 (74%) 300 (19. 1) Bright, R. A. , M. J. Medina, X. Xu, G. Perez-Oronoz, T. R. Wallis, X, M. Davis, L. Povinelli, N. J. Cox, and A. L. Klimov. 2005. Incidence of adamantane resistance among influenza A (H 3/N 2) viruses isolated worldwide from 1994 to 2005: a cause for concern. Lancet 366: 1175 -1181. 2. Kansas City 1. Carr, M. J. , N. Sayre, M. Duffy, J. Connell, and W. W. Hall. 2008. Rapid molecular detection of the H 275 Y oseltamivir resistance gene mutation in circulating influenza A (H 1 N 1) viruses. J. Virol. Methods, 153: 257 -262. 3. Cheng, P. , W. C. Leung, W. C. , E. Ho, P. Leung, A. Ng, M. Lai, and W. Lim. 2009. Oseltamivir- and Amantadine-Resistant Influenza Viruses A (H 1 N 1). Emerging Infect. Dis. , 15: 966 -968. 4. Kim, C. U. , W. Lew, M. A. Williams, H. Liu, L. Zhang, S. Swaminathan, et al. 1997. Influenza neuraminidase inhibitors possessing a novel hydrophobic interaction in the enzyme active site design, synthesis and structural analysis of carbocyclic sialic acid analogues with potent anti-influenza activity. J. Am. Chem. Soc. 119: 681 -690. 5. Lackenby, A. , O. Hungnes, S. G. Dudman, A. Meijer, W. J. Paget, A. J. Hay, et al. 2008. Emergence of resistance to oseltamivir among influenza A (H 1 N 1) viruses in Europe. Eurosurveillence, 13. 6. Laplante, J. M. , S. A. Marshall, M. Shudt, T. T. Van, E. S. Reisdorf, L. A. Mingle, P. A. Shult, and K. St. George. 2009. Influenza antiviral resistance testing in New York and Wisconsin, 2006 to 2008: Methodology and surveillance data. J. Clin. Microbiol. 47: 1372 -1378. 7. Suwannakarn, K, S. Payungporn, T. Chieochansin, R. Samransamruajkit, A. amonsin, T. Songserm, A. Chaisingh, P. Chamnanpood, S. Chutininimitkul, A. Theamboonlers, and Y. Poovorawan. 2008. Typing (A/B) and subtyping (H 1/H 3/H 5) of influenza A viruses by multiplex real-time RT-PCR assays. J. Virol. Methods, 152: 25 -31.


