Скачать презентацию Origin of Man and the Races Richard Deem Скачать презентацию Origin of Man and the Races Richard Deem

840e7fc7632d4ab8f4fc0550c56192cf.ppt

  • Количество слайдов: 109

Origin of Man and the Races Richard Deem, M. S. Reasons To Believe 1 Origin of Man and the Races Richard Deem, M. S. Reasons To Believe 1

mt. DNA General Outline Mitochondrial DNA – A small piece of • Biblical data mt. DNA General Outline Mitochondrial DNA – A small piece of • Biblical data and scientific data • Origin of man • Molecular and genetic data – mt. DNA and Y chromosome • Neandertals and humans DNA that codes for a small number of proteins within the energy-producing sub-cellular organelle known as the mitochondrion • Bipedal primates and chimpanzees • Origin of the races 2

Why All the Biology? And to the Jews I became as a Jew, that Why All the Biology? And to the Jews I became as a Jew, that I might win Jews; to those who are under the Law, as under the Law, though not being myself under the Law, that I might win those who are under the Law; to those who are without law, as without law, though not being without the law of God but under the law of Christ, that I might win those who are without law. To the weak I became weak, that I might win the weak; I have become all things to all men, that I may by all means save some. (1 Corinthians 9: 20 -22) 3

Origin of Man Classic Hypothesis European Humans African Humans Asian Humans Neandertals H. antecessor Origin of Man Classic Hypothesis European Humans African Humans Asian Humans Neandertals H. antecessor H. ergaster 4

Origins of Mammals • Soulish (nephesh) creatures created on days 5 and 6 Nephesh Origins of Mammals • Soulish (nephesh) creatures created on days 5 and 6 Nephesh The Hebrew word most often translated • Creation of specific mammals “soul, ” referring to both man and animals, including mind, will, and emotion (cattle, rodents, and carnivores) described for day 6. • Though not specifically mentioned, probably included the creation of bipedal primates 5

Origin of Man – Biblical Data Genesis 1: 26 Then God said, “Let us Origin of Man – Biblical Data Genesis 1: 26 Then God said, “Let us make (asah) man in our image, in our likeness… 6

Origin of Man – Biblical Data Genesis 1: 27 So God created (bara) man Origin of Man – Biblical Data Genesis 1: 27 So God created (bara) man in his own image, in the image of God he created (bara) him: male and female he created (bara) them. 7

Origin of Man – Biblical Data Genesis 2: 7 Then the LORD God formed Origin of Man – Biblical Data Genesis 2: 7 Then the LORD God formed (yatsar) man of dust from the ground, and breathed into his nostrils the breath of life; and man became a living being. (Genesis 2: 7) 8

Man – Part New, Part Old • Bara – created new, probably refers to Man – Part New, Part Old • Bara – created new, probably refers to the spiritual qualities, self -awareness, moral understanding • Asa, yatsar – made or formed from pre-existing material, probably refers to body and soul 9

Biblical Data – Garden of Eden Genesis 2: 10, 14 Now a river flowed Biblical Data – Garden of Eden Genesis 2: 10, 14 Now a river flowed out of Eden to water the garden; and from there it divided and became four rivers. And the name of the third river is Tigris; it flows east of Assyria. And the fourth river is the Euphrates. 10

Origin of Man – Biblical Data Dating human origins: • Adequate, but incomplete genealogies Origin of Man – Biblical Data Dating human origins: • Adequate, but incomplete genealogies • Ben and ab • ~10, 000 - 50, 000 years ago 11

Incomplete Genealogies Matthew 1: 8 1 Chronicles 3: 10 -12 and to Asa was Incomplete Genealogies Matthew 1: 8 1 Chronicles 3: 10 -12 and to Asa was born Jehoshaphat; and to Jehoshaphat, Joram; and to Joram, Uzziah; Asa his son, Jehoshaphat his son, Jehoram his son, Ahaziah his son, Joash his son, Amaziah his son, Azariah [Uzziah] his son 12

Incomplete Genealogies Genesis 5 -11 Luke 3: 34 -36 (reversed order) And Lamech… father Incomplete Genealogies Genesis 5 -11 Luke 3: 34 -36 (reversed order) And Lamech… father of a son… Noah, (Genesis 5: 2829). . . became the father of Shem. (Genesis 5: 32). . . The sons of Shem: Elam, Asshur, Arphaxad, Lud and Aram. (Genesis 10: 22). . . Arphaxad was the father of Shelah, and Shelah the father of Eber. Two sons were born to Eber: One was named Peleg (Genesis 10: 24 -25) the son of Serug, the son of Reu, the son of Peleg, the son of Heber, the son of Shelah, (Luke 3: 35) the son of Cainan, the son of Arphaxad, the son of Shem, the son of Noah, the son of Lamech, (Luke 3: 36) 13

Direct Descent? • ben – son, grandson, etc. • ab – father, grandfather Harris, Direct Descent? • ben – son, grandson, etc. • ab – father, grandfather Harris, R. L. , G. L. Archer, and B. K. Wilke. 1980. Theological Wordbook of the Old Testament, Vol. 1. Moody Press, Chicago, IL, pp. 5 -6, 113 -114. 14

Direct Descent? NASB Alternate Translation And Enosh lived ninety years, and became the father Direct Descent? NASB Alternate Translation And Enosh lived ninety years, and became the father of Kenan. (Genesis 5: 9) the family line that culminated with Kenan. (Genesis 5: 9) 15

How Many Generations? • Deuteronomy 7: 9 • 1 Chronicles 16: 15 • Psalms How Many Generations? • Deuteronomy 7: 9 • 1 Chronicles 16: 15 • Psalms 105: 8 1, 000 gen x 40 yr/gen = 40, 000 yr He has remembered His covenant forever, The word which He commanded to a thousand generations, (Psalms 105: 8) 16

Scientific Predictions for the Origin of Humans Creation Model 17 Scientific Predictions for the Origin of Humans Creation Model 17

Scientific Predictions Similarities with Other Animals • Anatomical – basic body plan • Physiological Scientific Predictions Similarities with Other Animals • Anatomical – basic body plan • Physiological – the way the body works • Biochemical – the chemical pathways and machines that underlie everything 18

Scientific Predictions Sudden appearance… • Human fossils • Human culture • Spiritual activity 19 Scientific Predictions Sudden appearance… • Human fossils • Human culture • Spiritual activity 19

Scientific Predictions Origin of man: • Traceable to a single man and a single Scientific Predictions Origin of man: • Traceable to a single man and a single woman • Recent origin 20

Scientific Predictions Origin of man: • All males directly related to Noah • All Scientific Predictions Origin of man: • All males directly related to Noah • All females directly related to Eve Females should be more genetically diverse 21

Scientific Data for Human Origins 22 Scientific Data for Human Origins 22

Molecular Anthropology Compare DNA sequences among modern human groups • Similarities and differences • Molecular Anthropology Compare DNA sequences among modern human groups • Similarities and differences • Extent of differences 23

Molecular Anthropology Gives • Date of humanity’s origin • Original population size 24 Molecular Anthropology Gives • Date of humanity’s origin • Original population size 24

Molecular Anthropology Gives • Pattern for humanity’s spread • Geographic location of humanity’s origin Molecular Anthropology Gives • Pattern for humanity’s spread • Geographic location of humanity’s origin 25

Mitochondrial DNA (mt. DNA) Male sperm contribute only genetic material and no cellular organelles. Mitochondrial DNA (mt. DNA) Male sperm contribute only genetic material and no cellular organelles. Y chromosome Therefore, all mt. DNA comes from the A small chromosome that determines egg, being passed down exclusively the sex of an individual. Embryos that by females. disequilibrium posses a Y chromosome become Linkage male. Therefore, the genetic The non-random association of alleles information on the Y chromosome is at different loci (or regions within DNA Microsatellites passed down only by males. sequences), not expected from the Microsatellites" are loci where short law of independent assortment. sequences of DNA are repeated in tandem arrays (one right after the other). Genetic Diversity Evidence • Mitochondrial DNA • Y chromosomal DNA • Linkage disequilibrium • Microsatellites 26

Genetic Diversity • Humanity had a recent origin • African origin • Small population Genetic Diversity • Humanity had a recent origin • African origin • Small population that rapidly expanded recently 27

Human Chromosome 21 Haplotype Diversity A combination of alleles (alternate forms of the same Human Chromosome 21 Haplotype Diversity A combination of alleles (alternate forms of the same gene) of closely linked loci that are found in a single chromosome and tend to be inherited together • Three haplotypes describe 80% of human population • Far fewer haplotypes than expected 28

Mitochondrial DNA • Humanity originated less than 150, 000 ya • Small population of Mitochondrial DNA • Humanity originated less than 150, 000 ya • Small population of women • Single location (Africa) 29

Y Chromosome Mapping Testis Determining Factor (TDF) Channel Surfing (SRF) Addiction to death and Y Chromosome Mapping Testis Determining Factor (TDF) Channel Surfing (SRF) Addiction to death and destruction movies (T-2) The need to always be right (TLD-U) Spitting and hacking (P 2 E) Inability to express affection (ME-2) Finding humor in bodily noises (BLCH) Inability to put toilet seat down (BIDET) Selective hearing loss (MUM) Inability to ask directions (LST) Ability to write name with urine (CMe. P) 30

Y Chromosome Data Study Dorit, et al. Hammer Total 95% CI Base Pairs Lower Y Chromosome Data Study Dorit, et al. Hammer Total 95% CI Base Pairs Lower Interval) CI (Confidence Upper Mean Pop. Size A statistical measure of the certainty 27, 702 0 800, 000 270, 000 7, 500 of a value. 95% CI means that there is a 95% probability that the result lies between the CI values. 39, 000 51, 000 411, 000 188, 000 5, 000 Whitfield, 91, 500 37, 000 et al. 49, 000 43, 000 N/A 31

Male vs. Female Divergence Age of Coalescence Y (Male) mt. DNA (Female) Minimum 37, Male vs. Female Divergence Age of Coalescence Y (Male) mt. DNA (Female) Minimum 37, 000 120, 000 Maximum 49, 000 474, 000 Whitfield, L. S. , J. E. Suston, and P. N. Goodfellow. 1995. Sequence variation of the human Y chromosome. Nature 378: 379 -380. 32

Y Chromosome Summary • Humanity originated less than 50, 000 ya • Small population Y Chromosome Summary • Humanity originated less than 50, 000 ya • Small population of men • Single location (Africa) 33

Linkage Disequilibrium • Humanity originated less than 50, 000 ya 34 Linkage Disequilibrium • Humanity originated less than 50, 000 ya 34

Origin of the Malaria Parasite • Originated less than 120, 000 ya • Resistance Origin of the Malaria Parasite • Originated less than 120, 000 ya • Resistance alleles appeared 3, 000 -12, 000 ya 35

Scientific Data 1500 Cranial Capacity (cc) Sudden appearance of modern humans in the fossil Scientific Data 1500 Cranial Capacity (cc) Sudden appearance of modern humans in the fossil record 1000 Homo 500 Australopithecines 0 1 2 Time (MYA) 3 36

Scientific Data Sudden appearance of human culture: • Sophisticated tool kit • Socioeconomic organization Scientific Data Sudden appearance of human culture: • Sophisticated tool kit • Socioeconomic organization • Art work • Spiritual expression 37

Sophisticated Tool Kit • A shift from predominantly “rake” to “blade” stone tool technology Sophisticated Tool Kit • A shift from predominantly “rake” to “blade” stone tool technology • Increased variety and complexity of stone tools involving a higher degree of “imposed form” • Complex and extensively shaped bone, antler, and ivory artifacts • Increased regional diversification of tool forms 38

Socioeconomic Organization • Specialized patterns of animal exploitation, based on systematic hunting • A Socioeconomic Organization • Specialized patterns of animal exploitation, based on systematic hunting • A sharp increase in the overall density of human population • An increase in the maximum size of local residential groups • Appearance of highly “structured” sites, including hearths, pits, huts, tents, and other habitations 39

Appearance of Modern Art 40 Appearance of Modern Art 40

Body Ornaments • Dated at 40, 000 years ago • No food value • Body Ornaments • Dated at 40, 000 years ago • No food value • Unusual designs and color 41

Spiritual Expression • Religious relics and altars date to 24, 000 ya • Artwork Spiritual Expression • Religious relics and altars date to 24, 000 ya • Artwork containing spiritual content dates to 5, 000 ya 42

Deleterious Mutations Conservative Realistic Overall 4. 2 Deleterious 1. 6 6. 7 3. 1 Deleterious Mutations Conservative Realistic Overall 4. 2 Deleterious 1. 6 6. 7 3. 1 "The deleterious mutation rate appears to be so high in humans and our close relatives that it is doubtful that such species, which have low reproductive rates, could survive if mutational effects on fitness were to combine in a multiplicative way. " Eyre-Walker, A. & Keightley, P. D. 1999. High genomic deleterious mutation rates in hominids. Nature 397, 344 -347. 43

Evidence Against the Design of Humans? • Pseudogenes present in great apes and humans Evidence Against the Design of Humans? • Pseudogenes present in great apes and humans Pseudogenes • Beta globin Regions of non-coding DNA (DNA that does not code for functional protein) that have been apparently • Enolase duplicated from functional genes. • Vitamin C • Assumes that God would never reuse previous designs 44

Summary - Scientific Data • Humans originated from a small population of males and Summary - Scientific Data • Humans originated from a small population of males and females • Recent origin of modern humans • ~ 50, 000 years ago • Humans originated suddenly and dramatically 45

Origin of Man “Out-of-Africa” Hypothesis African Humans European Humans Asian Humans Neandertals ? ? Origin of Man “Out-of-Africa” Hypothesis African Humans European Humans Asian Humans Neandertals ? ? H. antecessor ? H. ergaster 46

Who were the Neandertals? 47 Who were the Neandertals? 47

Who Were the Neandertals? • Lived ~150, 000 to ~30, 000 years ago • Who Were the Neandertals? • Lived ~150, 000 to ~30, 000 years ago • Inhabited Europe and western Asia 48

Who Were the Neandertals? Physical similarities with Bipedal (bipedalism) Ability to walk upright on Who Were the Neandertals? Physical similarities with Bipedal (bipedalism) Ability to walk upright on two legs. modern humans • Bipedal • Large brain capacity 49

Physical Differences Between Neandertals and Humans Brain shape Receding forehead Neandertal Brow ridge Large Physical Differences Between Neandertals and Humans Brain shape Receding forehead Neandertal Brow ridge Large eye sockets Large front teeth Chin Occipital bun receding Retromolar gap Modern Human 50

Physical Differences Between Foramen magnum Pterygoid tubercle The area where the spine joins the Physical Differences Between Foramen magnum Pterygoid tubercle The area where the spine joins the Neandertals and Humans A small rounded nodule on the skull Pterygoid bone in the roof of the mouth connecting the palatine in front and the quadrate behind. • Elongated foramen magnum • Medial pterygoid tubercle • Flatter skull base 51

Physical Differences Between Neandertals and Humans • Large nose • Large sinuses • Structure Physical Differences Between Neandertals and Humans • Large nose • Large sinuses • Structure of the inner ear • Higher larynx Chimp Neander. Human 52

Physical Differences Between Neandertals and Humans • Thicker bones • Barrel chests Metacarpals • Physical Differences Between Neandertals and Humans • Thicker bones • Barrel chests Metacarpals • Shorter limbs The bones that connect the wrist bones (carpals) with the finger bones (phalanges). • Asymmetrical humerus • Thicker metacarpals 53

Craniodental A fancy word referring to the skull and teeth Neandertal Development • Craniodental Craniodental A fancy word referring to the skull and teeth Neandertal Development • Craniodental development of Neandertals and humans differs from before birth • Differences occur from the time Neandertals first appear 54

Molecular Paleontology: Neandertal mt. DNA 40, 000 YA Neander, Germany Northern Vindija Cave, Caucasus Molecular Paleontology: Neandertal mt. DNA 40, 000 YA Neander, Germany Northern Vindija Cave, Caucasus Croatia 40, 000 YA 29, 000 YA 55

DNA 101 • DNA language: • 4 “letters” in the alphabet A – Adenine DNA 101 • DNA language: • 4 “letters” in the alphabet A – Adenine C – Cytosine T – Thymine G – Guanine • 20 3 -letter “words” (codons) Each codon codes for one amino acid • Unlimited number of “sentences” (proteins) • Unlimited number of “novels” (organism) 56

Neandertal mt. DNA Sample (HVR-1) Sequence Number (Read Down) 11111111111111111 66666666666666666 0000111111122222233334 378900112345568880233455667912571 786378129984692399304468238910420 Neandertal mt. DNA Sample (HVR-1) Sequence Number (Read Down) 11111111111111111 66666666666666666 0000111111122222233334 378900112345568880233455667912571 786378129984692399304468238910420 Mod. Human AATTCCCCGACTGCAATTCACGCAC-CATCCTC Chimpanzee. . . T. ATT. . . ACTGAAA. . G. . Neander. #1 GG. CTTTTATTC. T. CCCTGTAAGTATGCT. CT Neander. #2 . C. . . ATT. ATCCCCTGTAA. TATGCTTC Neander. #3 GG. . . ATTC. TCCCCTGTAAGTATGCT. C Neander. #4 GG. . . ATTC. TCCCCTGTAA. TATGCT. C 57

Neandertals – Limited Genetic Diversity Population Neandertals Humans mt. DNA differences # Individuals Mean Neandertals – Limited Genetic Diversity Population Neandertals Humans mt. DNA differences # Individuals Mean Min. Max. 3 3. 73 5, 530 3. 43 - - 0. 00 10. 16 Chimpanzees 359 14. 81 0. 00 29. 06 Gorillas 28 18. 57 0. 40 28. 79 58

Ancient Modern Human mt. DNA Age (ka) Sequence Number (Read Down) 0011111111222222222222223333333 79001122345668889001223344444555566677888899901112345556688 83781269984393499198340413479368923448467803911780715672817 Ancient Modern Human mt. DNA Age (ka) Sequence Number (Read Down) 0011111111222222222222223333333 79001122345668889001223344444555566677888899901112345556688 83781269984393499198340413479368923448467803911780715672817 Modern Human 0 ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA Aboriginal 0 . . . CA. . . TC. . CTT. . TC. . CTA. . . T. T. G. C. . TT. TC. C. . . Chimp 0 . . T. . ATT. . . AA. C. TCGA. CA. . . TG. . CG. . CT. T. T. C. C. . Neander #1 30+ GCTTTT. ATTC. T-. CC. C. T. GT. . AG. T. . . . G. C. . T. . . C. . . Ancient Aussie 62 . . T. G. . . CT. T. . . . TC. . G mt. DNA Sample (HVR-1) 59

Neandertal mt. DNA Summary • Neandertals have no genetic (nor evolutionary) connection to humans Neandertal mt. DNA Summary • Neandertals have no genetic (nor evolutionary) connection to humans • Neandertals displayed limited genetic diversity 60

Origin of Man Classic Hypothesis European Humans African Humans Asian Humans Neandertals H. antecessor Origin of Man Classic Hypothesis European Humans African Humans Asian Humans Neandertals H. antecessor H. ergaster 61

Origin of Man Multi-regional Hypothesis European Humans ? African Humans Neandertals ? ? Asian Origin of Man Multi-regional Hypothesis European Humans ? African Humans Neandertals ? ? Asian Humans H. erectus ? H. antecessor H. ergaster 62

Multiregional Hypothesis Requires • Large breeding populations over the entire planet • Frequent interbreeding Multiregional Hypothesis Requires • Large breeding populations over the entire planet • Frequent interbreeding of those populations • Genetic roots traceable to millions of years bp 63

Genetic Data Contradicts Multiregional Hypothesis Study 1 • African and Asian and oceanic peoples Genetic Data Contradicts Multiregional Hypothesis Study 1 • African and Asian and oceanic peoples originated from same population group 35 -89 kya Study 2 • 90% of founding population must come from Africa and this population must be small 64

Genetic Data Contradicts Multiregional Hypothesis Study 3 (small population size) • Nuclear DNA sequences Genetic Data Contradicts Multiregional Hypothesis Study 3 (small population size) • Nuclear DNA sequences • Alu insertions • HLA exons • mt. DNA mismatch distributions • frequency spectra (mt. DNA, Y-chr) • allele size vs. homozygosity at tandem repeat loci 65

Homo erectus Development • Homo erectus developed in a fashion similar to great apes Homo erectus Development • Homo erectus developed in a fashion similar to great apes – not modern humans • Homo erectus developed from infanthood to adulthood rapidly 66

Descent of Modern Humans “Most of the familiar specimens of Homo erectus and of Descent of Modern Humans “Most of the familiar specimens of Homo erectus and of archaic humans known from the Pleistocene were not members of populations ancestral to us” Harpending, H. C. , et al. 1998. Genetic traces of ancient demography. Proc. Natl. Acad. Sci. USA 95: 1961 -1967. 67

Origin of Man Multi-regional Hypothesis European Humans ? African Humans Neandertals ? ? Asian Origin of Man Multi-regional Hypothesis European Humans ? African Humans Neandertals ? ? Asian Humans H. erectus ? H. antecessor H. ergaster 68

Scientific Data Similarities with other animals • Anatomical – overall structure and body plan Scientific Data Similarities with other animals • Anatomical – overall structure and body plan • Physiological – how the body systems work and interact • Biochemical – basic chemical pathways 69

Scientific Data Human – Chimpanzee genetics • ~95 -99% Genetic Similarity • Base substitutions Scientific Data Human – Chimpanzee genetics • ~95 -99% Genetic Similarity • Base substitutions – 1. 4% • Insertions/Deletions – 3. 4% • Common Descent (? ) 70

Humans and Chimpanzees • Chromosome number • Human (46) • Chimp (48) • Chromosome Humans and Chimpanzees • Chromosome number • Human (46) • Chimp (48) • Chromosome sizes • Chromosomal banding • #2 equivalent to two smaller chimp chromosomes • #4 and #17 different 71

Chromosome 21 Human-Chimp Comparison HS 21 Clone Gaps PCR Result Chimp and other primates- Chromosome 21 Human-Chimp Comparison HS 21 Clone Gaps PCR Result Chimp and other primates- • Chromosome 21 fully sequenced annotated • Two clusters with significant differences 72

How Different From Chimpanzees? • Human problem – anthropomorphizing • The counting dog • How Different From Chimpanzees? • Human problem – anthropomorphizing • The counting dog • What do chimpanzees really understand? 73

Human Distinctives • Large brain size • Bipedalism • Advanced culture • Decreased size Human Distinctives • Large brain size • Bipedalism • Advanced culture • Decreased size of back teeth 74

Emergence of Bipedalism Driven by habitat change from wood-land to open savanna? 75 Emergence of Bipedalism Driven by habitat change from wood-land to open savanna? 75

Bipedalism Theories Theory Problems Ecology (Woodland Occurred later 1 to Savanna) Hunting and tools Bipedalism Theories Theory Problems Ecology (Woodland Occurred later 1 to Savanna) Hunting and tools Occurred later 1 Thermoregulation 2 Occurred later 1 Enhanced vision Wrong environment hominids were reproductively disadvantaged 4 Not fully supported by the data 76 Male provider 3 Scarce dietary resources

Advantages of Bipedalism • Travel for food • Transport food • Feed in stationary Advantages of Bipedalism • Travel for food • Transport food • Feed in stationary position • Avoid predatory attacks • Thermoregulatory advantages • Tool use 77

Valgus angle The angle the femur (leg bone) makes relative to the knee. About Valgus angle The angle the femur (leg bone) makes relative to the knee. About 90 degrees in apes, less in bipeds Human Great Ape Anatomy of Bipedalism • Shorter/broader pelvis • Valgus angle • Knee • Lengthened lower limbs • Enlarged joint surfaces 78

Anatomy of Bipedalism • Restructuring of ear bones • Platform foot • Foot arches Anatomy of Bipedalism • Restructuring of ear bones • Platform foot • Foot arches • Relocation of hallux (big toe) Human Great Ape 79

Anatomy of Bipedalism • Relocation of foramen magnum Human Great Ape • Lower/upper spine Anatomy of Bipedalism • Relocation of foramen magnum Human Great Ape • Lower/upper spine curvature • Restructuring of rib cage • Rearrangement of musculature 80

Ecology of Bipedalism Early australopithecines lived in mixed woodland savanna • • A. ramidus Ecology of Bipedalism Early australopithecines lived in mixed woodland savanna • • A. ramidus (5. 8 and 4. 5 mya) A. anamensis (4. 2 mya) A. afarensis (3. 9 mya) A. bahrelghazari (3. 5 mya) 81

Natural History of Bipedalism Facultative bipeds • A. ramidus (5. 8 mya) • A. Natural History of Bipedalism Facultative bipeds • A. ramidus (5. 8 mya) • A. anamensis (4. 2 mya) • A. habilis (2. 5 mya) 82

Natural History of Bipedalism Obligatory bipeds (type I) • H. erectus (2 million years Natural History of Bipedalism Obligatory bipeds (type I) • H. erectus (2 million years ago) • H. neandertalensis (150, 000 years ago) 83

Natural History of Bipedalism Obligatory bipeds (type II) • Homo sapiens (modern humans) (50, Natural History of Bipedalism Obligatory bipeds (type II) • Homo sapiens (modern humans) (50, 000 years ago) 84

Bipedalism in Hominins Man (Homo sapiens) Large brain, small teeth, obligate biped Hominins Small Bipedalism in Hominins Man (Homo sapiens) Large brain, small teeth, obligate biped Hominins Small brain, very large teeth, facultative biped H. neandertalensis Small brain, large teeth, facultative biped H. heidelbergensis Superfamily including the hominids Small brain, small teeth, quadruped H. antecessor (Genus Homo and Australopithecus) Insufficient evidence H. erectus along with the bipedal apes and H. ergaster H. rudolfemsis chimpanzees. A. habilis K. platyops A. anamensis A. bahreighazali A. garbi A. afarensis A. africanus P. robusts S. tchadensis P. aethiopicus A. ramidus P. boisei O. tugenesis Chimpanzee (Pan) 0 1 2 3 4 5 Time (MYA) 6 7 8 85

Emergence of Bipedalism • Minimal driving force/selective pressure • Appears suddenly in the fossil Emergence of Bipedalism • Minimal driving force/selective pressure • Appears suddenly in the fossil record • Requires major anatomical rearrangement • Rapid change followed by period of no change 86

Origin of Man Creation Model All Humans ADAM & EVE All other bipedal primate Origin of Man Creation Model All Humans ADAM & EVE All other bipedal primate species are a special creation of God 87

Origin of the Human Races Biblical and Scientific Explanations 88 Origin of the Human Races Biblical and Scientific Explanations 88

Origin of the Races God’s original command: And God blessed them; and God said Origin of the Races God’s original command: And God blessed them; and God said to them, "Be fruitful and multiply, and fill the earth. . . " (Genesis 1: 28) 89

Origin of the Races God reissued his command: Origin of the Races God reissued his command: "and as for you, be fruitful and multiply; Populate the earth abundantly and multiply in it. " (Genesis 9: 7) 90

World Peace and Unity? Human pride and greed result in oppression of people • World Peace and Unity? Human pride and greed result in oppression of people • Media-Persia • Greece • Rome 91

God’s Peace and Unity • “Do you suppose that I came to grant peace God’s Peace and Unity • “Do you suppose that I came to grant peace on earth? I tell you, no, but rather division; ” (Luke 12: 51) • “Peace I leave with you; My peace I give you. I do not give to you as the world gives. ” (John 14: 27) 92

Early Post-Flood Civilization Biblical data • Rapid repopulation of Mesopotamia • Nimrod built 8 Early Post-Flood Civilization Biblical data • Rapid repopulation of Mesopotamia • Nimrod built 8 large cities, including Nineveh 93

Scattering of the World’s People Biblical data • At the city of Babel, the Scattering of the World’s People Biblical data • At the city of Babel, the people began building a huge tower • God confused their language and scattered them over the face of the earth 94

Scattering of the World’s People • Geographic barriers • Bering Strait – Americas and Scattering of the World’s People • Geographic barriers • Bering Strait – Americas and Asia • Strait of Malaca – Indonesia and Asia • Torres Strait – Australia and Asia • Land bridges established by the ice age 95

Dividing the Earth • Biblical data • Two sons were born to Eber: One Dividing the Earth • Biblical data • Two sons were born to Eber: One was named Peleg, because in his time the earth was divided… (Genesis 10: 25) • Scientific Data • Land bridges covered by rising oceans ~11, 000 ya 96

Origin of the Races What the Bible says • Moses married a Cushite woman) Origin of the Races What the Bible says • Moses married a Cushite woman) (Numbers 12: 1) • Solomon married a black woman (Song of Songs 1: 5) • Ethiopians described as darkskinned (Jeremiah 13: 23) 97

Origin of the Races What the Bible doesn’t say • When and how did Origin of the Races What the Bible doesn’t say • When and how did the races begin? • No biblical data – Not important enough to mention? • Mark of Cain? • Ham’s penalty? • Part of the scattering at the Tower of Babel? 98

Origin of the Races Race facts: • Single biological species - Homo sapiens. • Origin of the Races Race facts: • Single biological species - Homo sapiens. • Race described on the basis of skin color, hair form, facial morphology, body proportions, and other, less obvious traits – not based upon genetics 99

Origin of the Races Scientific classification • African (groups indigenous to Africa) • Caucasian Origin of the Races Scientific classification • African (groups indigenous to Africa) • Caucasian (European populations) • Greater Asian (Mongols, Polynesians, Micronesians) • Amerindian (North & South American Indians, Eskimos) • Australoid (Australia, Papua) 100

Biological Basis for Race • No specific “race genes” • Skin color – melanin Biological Basis for Race • No specific “race genes” • Skin color – melanin (phenomelanin and eumelanin) • Melanin expression – controlled by the enzyme tyrosinase • All people have enough tyrosinase to be very black in skin color • Regulation of the tyrosinase determines skin color 101

Origin of the Races Protein polymorphisms • 84% of all variation is found within Origin of the Races Protein polymorphisms • 84% of all variation is found within each racial group • 10% of variation is found among racial groups • More genetic variation within races than between them 102

Skin Color Distribution Vs. Blood Type Relative Skin Color equator Type A Type B Skin Color Distribution Vs. Blood Type Relative Skin Color equator Type A Type B 103

“Racial” Diversity Among Chimpanzees Compared to Humans Measure Chimps Humans X-chromosome 0. 13% 0. “Racial” Diversity Among Chimpanzees Compared to Humans Measure Chimps Humans X-chromosome 0. 13% 0. 037% mt. DNA (MPSD) 14. 8 3. 4 Fst values >2. 0 0. 08 Substitution rate >0. 05 0. 029 Heterozygosity 3. 9% 1. 8% 104

Scientific Theories on the Origin of Human Races • Dark skin protects against ultraviolet Scientific Theories on the Origin of Human Races • Dark skin protects against ultraviolet radiation and cancer • Light skin allows enhanced formation of vitamin D 3 • Exception – Inuit (Eskimos) • Selective breeding 105

Origin of Races – Conclusions • The origin of the races was not thought Origin of Races – Conclusions • The origin of the races was not thought to be important enough to put in the Bible • Biological changes required to produce human races are well within those possible through microevolutionary processes 106

Modern Humans – Comparison of Models Appearance Creation Darwinism Fossils Suddenly Gradual Culture Rapid Modern Humans – Comparison of Models Appearance Creation Darwinism Fossils Suddenly Gradual Culture Rapid Gradual Location Descent Single site Many sites? None Unknown ancestor 107

Summary • Modern humans originated recently from a small population at a single geographic Summary • Modern humans originated recently from a small population at a single geographic location • Modern culture and religious expression appeared suddenly and dramatically • Modern humans are not descended from Neandertal, H. erectus or any other identifiable bipedal hominid 108

Conclusions • Naturalistic explanations fail to explain the origin of modern man • Supernatural Conclusions • Naturalistic explanations fail to explain the origin of modern man • Supernatural creation is a superior model for understanding man’s origin • The races of man likely originated from selective breeding and not a supernatural act, although they may have been the indirect result of the scattering at the tower of Babel 109