1 Pushino 2014 4 2.ppt
- Количество слайдов: 73
Нейрогенетика болезней мозга и поведения Evgeny. Rogaev@Umassmed. edu rogaev@vigg. ru
Pleurobrachia bachei (A. Agassiz, 1860)
Human Brain (100 billion cells) is our most vital organ responsible for everything Involuntary life support function (heartbeats and breathing); essence of personality and memory Most if not all, of the neurons remain healthy until you die (if no a specific brain disease) Brain loses only 5 -10 % of its weight between the age of 20 and 90
Brain Molecular Genetics Search for Mutant Gene BRAIN EVOLUTION BRAIN DEVELOPMENT DISORDERS MENTAL RETARDATION ALCOHOLISM DEPRESSION SCHIZOPHRENIA DEMENTIA Mechanism of Molecular and Cellular Pathology
Missing left hemisphere, Michelle Mack’s case
Differences in cerebral cortical size are associated with differences in the cerebral cortex circuit diagram Hill, R. S. & Walsh, C. A. (2005) Nature, 437(7055), 64 -7
Homo sapiens is distinguished from other primates by unique social cognition traits. The prefrontal cortex of human brain plays a central role in social behavior control, personality, intelligence, working memory and “executive functions” e. g. , intelligent abilities to differentiate good and bad or right or wrong and to suppress socially inappropriate actions. Dysfunction of prefrontal neocortex may lead to massive personal changes and has been observed in sociopaths, criminal, drug addicts and also in patients with bipolar psychosis, schizophrenia and Attention Deficit Hyperreactivity Disorder (ADHD).
Microcephalia vera (“true microcephaly”) microcephaly норм Ген ASPM Bond et al. , 2002
Mutations for microcephaly and mental retardation MCPH 1 gene Microcephalin ASPM gene Abnormal spindle-like microcephly associated protein Cox et al. , 2006
Family with autosomal-recessive cerebellar hypoplasia (CH), mental retardation and quadrupedia linked to chromosome 17 q (QD-K 1 family).
Brazilian family with quadrupedal locomotion and severe mental retardation I II IV * * *
Mouse, Gene bearing mutation in quadrapedia http: //mouse. brain-map. org/experiment/show/69257713 Gene expression Is restricted to cerebellum
Genetic Methods and Brain Diseases
Genetic Terms • Concordance in genetics means the presence of the same phenotype (disease) trait in both members of a pair of twins • Penetrance in genetics means the proportion of the individuals with the mutation who exhibit the mutation • 95% penetrance for autosomal dominat disorder: 95% of those with the mutation will develop the disease • Complete of highly penetrant mutation (or allele): all or almost all individuals The disease mutation have clinical symptoms of the disease; Incomplete or low penetrant mutation: will only sometimes produce the symptoms (difficult to distinquish environmental from genetic factors)
Heritability of addictive disorders Goldman, D. , Oroszi, G. & Ducci, F. (2005) Nature Reviews Genetics 6, 521 -532
Identification of novel genes • Biochemical analysis: protein product • Genetic linkage analysis: positional cloning • Genetic Association analysis: - SNP in candidate genes - Genome wide association analysis with >300 -500 000 SNPs
Genetic Markers for Linkage and Association Analysis Mutation in gene and polymorphic markers STR markers: more information from each SNP markers: more frequent in genome
Позиционное клонирование: анализ сцепления Ядерные полиморфные ДНКмаркеры и гены, локализованные на одной хромосоме, имеют тенденцию оставаться сцепленными после мейоза Локализаци гена может быть установлена по известному положению полиморфного ДНКмаркера Сцепление неполное из-за внутрихромосомной рекомбинации Частота рекомбинации пропорциональна расстоянию между генами на хромосоме: 1% рекомбинации = 1 с. М
Sequencing workflow Large eukaryotic genomes, transcriptoms, epigenomics 2 computer clusters Illumina Hi. Seq 2000 Small genomes, transcriptoms, epigenomics NGS-pipeline – our program framework for whole genome analysis http: //code. google. com/p/ngs-pipeline/ Life Technologies, Solid 4 Life Technologies, 5500 xl
Genetics and genes for neuropsychiatric diseases Psychiatric and Neurodevelopment Neurodegenerative Diseases • Mental retardation Alzheimer’s and other Dementias • Autism Parkinson Disease • Eating behavior diseases Prion Diseases • Addiction disorders Ataxia and movement disorders • Affective diseases • Schizophrenia -
Trinucleotide Repeat Disorders Gallegher, 2005
Dementia: memory Impairment combined with aphasia, apraxia, agnosia or disturbance in executive functioning
Alzheimer’s Dementias
Identification of AD gene by “Functional” approach. “Peptide” sequence helped to clone APP gene for AD The 59 base oligonucleotide probe with universal base deoxyinosine (I) in every third position, corresponding to the first 20 amino acids of Alzheimer's disease beta -amyloid (Aβ) was used for hybridization with human brain c. DNA library. Goldgaber et al. , Science, 1987 Amyloid Precursor Protein (APP)
Positional Cloning of Presenilin 1 and Presnilin 2 Genes Mutations (red letters) found in Presenilin 1 gene in early-onset Alzheimer’s Disease families ( Nature , 1995 а, 1995 в)
APP cleavage NH 2 α-secretase γ-secretase ADAM family of PSEN 1, PSEN 2 metalloproteases (combined activity of ADAM 9, 10, 17 (TACE)) P 3 Ab β-secretase γ-secretase BACE 1, 2 PSEN 1, PSEN 2 Ab COOH
Acne inversa-associated loss-of-function mutations in γsecretase genes. Wang et al. , Science, 2010 Kelleher & Shen, Science, 2010
Genetic versus Environmental factors: brain trauma and anesthesia • Head injury doubles the risk of Alzheimer's disease Scott Gottlieb, BMJ. 2000 November 4; 321(7269): 1100. • Consensus statement: first international workshop on anesthetics and Alzheimer's disease. Baranov D. et al. Anesth. Analg. 2009, 108, 1627– 1630. • Isoflurane and desflurane at clinically relevant concentrations induce amyloid beta-peptide oligomerization: an NMR study. Mandal P. K. , Fodale V. Biochem. Biophys. Res. Commun. 2009), 379, 716– 720 http: //www. braininjury. com/injured. shtml
Frontotemporal dementia brains Mayo Foundation for Medical Education and Research
Genetic factors of non-AD dementias Disease Gene Encoded protein Gene location Microtubule associated protein tau Frontotemporal dementia (FTD) MAPT GRN (PGRN) Other genes Granulin (or Progranulin) 17 q 21. 1 17 q 21. 32 Dementia with Lewy bodies (DLB) SNCA SNCB alpha-synuclein beta-synuclein 4 q 21 5 q 35 CADASIL (Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy) dementia NOTCH 3 neurogenic locus notch homolog protein 3 19 p 13. 2 -p 13. 1 Familial British dementia (FBD) Familial Danish dementia (FDD) ITM 2 B or BRI(2) integral membrane protein 2 B 13 q 14. 3 Creutzfeldt–Jakob dementia (CJD) PRNP prion protein Pr. P 20 p 13 Huntington disease (HD) HTT huntingtin 4 p 16. 3 Amyotrophic lateral sclerosis (ALS) SOD 1 ATXN 2 VCP TDP 43 FUS superoxide dismutase ataxin-2 valosin-containing protein TAR DNA-binding protein 43 RNA-binding protein FUS 21 q 22. 11 12 q 24. 1 9 p 13. 3 1 p 36. 2 16 p 11. 2
Cats painted in the progression of psychosis of a SCHIZOPHRENIC artist Louis Wain Normal period Psychotic period stage 1 stage 2 stage 3 stage 4 stage 5
Rates of Schizophrenia Among Relatives of Schizophrenic Patients NARSAD Source: Gottesman, 1991
Schizophrenia: hypothesis Aberrant neurodevelopment early in life normal de novo cell production but aberrant insertion into neuronal network? Neurotransmitter signaling imbalance Dopaminergic mechanisms antogonism of D 2 dopamine receptors only property common to all known antipsychotic drugs; Glutamatergic mechanisms: hypofunction of NMDA signaling Antagonists for glutamate receptor (NMDA- N-methyl-D-aspartate) such as phencyclitidine and ketamine induce both positive and negative symptomes in normal subjects
Novel Approaches: Massive Parallel Sequencing Identification of mutant gene by direct sequencing of exons of all genes in family trio Search for de novo Mutation In Schizophrenia Targeted exome capture (whole exome sequencing) Hiseq 2000 (Illumina) Mardis, Genome Biology, 2010
Rare mutations: NMDA signaling, synaptic function New search for genes for behavioral traits Concept • Genetic and Epigenomic Interactions
H 3 K 12 acetylation m. Cp. G Epigenetic Decoration of Nucleosomes in Human Brain: Histone modifications and DNA methylation
Epigenome Mapping in Neuronal Nuclei (Neu. N+) from Prefrontal Cortex In schizophrenia (collaboration with S. Akbarian)
Wide-Genome quantitative analysis of active chromatin loci marked by H 3 k 4 me 3 histones in schizophrenic (red) versus control (blue) brain neurons Example 1: 2 fold up
Гены влияют и на риск злоупотребления алкоголем, и на выпиваемое количество алкоголя Выявлены две группы генов, ассоциированные с риском развития алкоголизма: - Гены, контролирующие метаболизм алкоголя - Гены, контролирующие функции мозга
КТО ВИНОВАТ И ЧТО ДЕЛАТЬ? 85 Мужчины Males 80 80 75 Females Женщины 75 EU 70 70 65 65 60 Россия 60 55 1950 1970 1990 2010 55 1950 1970 1990 Демоскоп Weekly № 417 – 418 5 - 18 апреля 2010 http: // 85 По данным: А. Вишневский. Сбережение народа на фоне депопуляции Ожидаемая продолжительность жизни при рождении Причины распространения социально значимых заболеваний и низкой продолжительности жизни в России. 2010 Россия относится к странам с наиболее высокими показателями смертности и наиболее высокими различиями в смертности между различными социо-экономическими группами. В России продолжительность жизни в последнее десятилетия не возросла (менее 65 лет для мужчин), а в ряде стран Европы она больше на 10 -15 лет.
В РОССИИ ОКОЛО 40% СМЕРТНОСТИ МУЖЧИН ТРУДОСПОСОБНОГО ВОЗРАСТА СВЯЗАНО С АЛКОГОЛЕМ В период полусухого закона гены не изменились, а пить стали меньше А. В. Немцов Алкогольная смертность в России: 1980 -1990 -е годы
Алкоголь и альдегид разрушается ферментами. У разных людей они работают с разной скоростью ADH 1 B Arg 47 His; ALDH 2 12 Glu 487 Lys ы ц пей ро . ADH 1 B Ев ALDH 2 медленно быстро предковый аллель Этанол ЯД окисляется медленно А ели ЮВ Жит Этанол ацетат Ацетальдегид окисляется быстро ALDH 2 медленно ADH 1 B быстро Ацетальдегид Этанол окисляется медленно Ацетальдегида много, окисляется медленно флашсиндром
Географическое распределение эволюционно молодых аллельных вариантов генов быстро превращающих алкоголь в яд и медленно этот яд разрушающих НАМИ ПОКАЗАНО, ЧТО ПО ЭТИМ ГЕНАМ РУССКИЕ НИЧЕМ НЕ ОТЛИЧАЮТСЯ ОТ ЕВРОПЕЙЦЕВ. Borinskaya et al. Distribution of the Alcohol Dehydrogenase ADH 1 B*47 His Allele in Eurasia. American Journal of Human Genetics. 2009, 84: 89 -92. Li et al. Refined Geographic Distribution of the Oriental ALDH 2*504 Lys Variant // Annals of Human Genetics. 2009, 73: 335 -345. Географическое распределение частот аллелей ADH 1 B* «быстрый» ALDH 2 «медленный»
Агрессия “Зло – злом… Надобно было уничтожать причины преступлений (среду). Но не в одних причинах преступление: не в среде” Достоевский.
МОНОАМИНОКСИДАЗА МАОА работает дворником, выметая «лишние» нейромедиаторы MAOA Из Википедии: синапс
Mutation T=>G in gene for МАОА in family with aggression in males Х-linked
Behavioral traits Monogenic case Monoamine oxidase A • • Aggression in males in large kindred • X-chromosome monogenic inheritance • Linkage to gene of momoamine oxidase A (MOAA) • Mutation in exon 8: Glu -> stop codon • Deficiency in MOAA enzyme Aggression Arson Exhibitionisms Attempted rape Bruner et al, Science, 262, 578 -580
X-Linked MAOA gene and aggressive behavior in rodents
ХОРОШИЕ НОВОСТИ: СРЕДА ВЛИЯЕТ НА ПРОЯВЛЕНИЕ ГЕНОВ СВЯЗЬ АНТИСОЦИАЛЬНОГО ПОВЕДЕНИЯ, УСЛОВИЙ ВОСПИТАНИЯ И ГЕНОТИПА ПО ГЕНУ МАОА ИНДЕКС АНТИСОЦИАЛЬНОГО ПОВЕДЕНИЯ • Нападение с целью нанесения повреждений • Убийство • Изнасилование • Нападение на женщину • Жестокость по отношению Низкая активность МАОА n=163 чел. Высокая активность МАОА n=279 чел. • к животным Нет Возможно Тяжелые ПЛОХИЕ УСЛОВИЯ
Farm Lab Model: Transformation of Behavioral Paradigm Artificial selection for aggressive and friendly behavior Agressive fox mink rat Tame/friendly fox mink
rn is ), h Making friends
Ручные лисы Агрессивные лисы beta-2 adrenergic receptor ADRB 2 gene рецепторы чувствительны к адреналину преимущественно находятся на нейронах, клетках гладких мышц, печени Неселекционируемые лисы
Стресс: Гипоталамо-гипофизарно-надпочечниковая система Гипоталамус Гиппокамп глюкокортикоиды Кортикотропинрелизинг фактор Гипофиз АКТГ Надпочечники адреналин глюкокортикоиды Клетки иммунной системы
При чрезмерной силе или длительности стрессового ответа нарушаются функции организма и самих адаптационных систем Развитие соматической и психологической декомпенсации происходит по механизму «слабого звена» , когда не выдерживает нагрузки одна из стресс зависимых систем http: //ru. wikipedia. org/wiki/%D 0%9 C%D 0%B 8%D 0%B 4%D 1%80%D 0%B 8%D 0%B 0%D 0%B 7 Увеличение сердцебиения, повышение кровяного давления повышение свертываемости крови Гипертония, повреждения сердечнососудистой системы, инфаркты, инсульты Мобилизация жиров Гиперлипидемия, риск атеросклеротических изменений Повышение уровня сахара Изменение гемодинамики и тонуса мускулатуры кишечника Сужение сознания - концентрация на источнике опасности, что позволяет частично или полностью игнорировать не относящиеся к нему сигналы Гипергликемия, диабет II Повреждение слизистой ЖКТ, язвенная болезнь ПТСР, панические атаки, иные психические расстройства
ТРАСПОРТЕР СЕРОТОНИНА Забирает серотонин из синаптической щели обратно в выпустивший его нейрон Транспортер серотонина серотонин рецепторы Из Википедии: синапс
серотонин VNTR-ПОЛИМОРФИЗМ ПРОМОТОРНОГО УЧАСТКА ГЕНА ТРАНСПОРТЕРА СЕРОТОНИНА 8 повторов L-аллель tgcagcccccccagcatctcccctgcacccccagcatcccccc . . ctgcaccccccagcatcccccc tgcagcccttccagcat. . 6 повторов S-аллель (низкий уровень экспрессии)
Сообщают о наличии Self reports of depression депрессии symptoms, age 26 Связь между перенесенными стрессами и сообщениями The association between Stressful Life Events and о депрессии в возрасте 26 лет в зависимости от генотипа self-reports of depression symptoms at age 26, as по гену транспортера серотонина (SERT) a function of SERT genotype низко-активный ген (гомозиготы) гетерозиготы высокоактивный ген (гомозиготы ) 5 -HTT gene Хорошие Терпимые Плохие Five groups of individuals having different numbers of life events, ages 21 -26 условия Caspi et al. , Science 2003
Man with all his noble qualities … still bears in his bodily frame the indelible stamp of his lowly origin – Charles Darwin Acknowledgement: Borinskaya S. and Kirgizova V. for assistance in slide preparation
Гены поведения: Узнать как устроено, Управлять молекулярными (идентификация, диагноз) процессами (лечение)
SNP markers for genetic mapping or genome wide association study (GWAS): >500, 000 SNPs
SNP в промоторе гена рецептора глюкокортикоидов NR 3 C 1 : ассоциация с депрессией Интрон-экзонная структура гена NR 3 C 1 Гипоталамо-гипофизарнонадпочечниковая система rs 10482605 изоформа GR-alpha – активируемый лигандом транскрипционный фактор изоформа GR-beta может ингибировать транскрипционную активность GR-alfa p=0. 02 Аллель T Аллель C
Loci and Genes linked to Familial Parkinson's Disease PINKI LRRK 2 Dawson & Dawson, 2003 Gallegher, 2005
Prion gene and protein structures and mutations causing Creutzfeldt –Jakob disease (g. CJD) and fatal familial insomnia (FFI). Capellari et al. , 2010
The tripartite synapse The processes of astrocytes are intimately associated with synapses. This association is both structural and functional. a, Electron micrograph showing a tripartite synapse in the hippocampus. The astrocyte process (blue) ensheaths the perisynaptic area. The axon of the neuron is shown in green, with the dendritic spine in yellow and the postsynaptic density in red and black. Reproduced, with permission, from ref. 22. b, Schematic representation of a tripartite synapse. Perisynaptic astrocyte processes contain transporters that take up glutamate (Glu, green circles) that has been released into the synapse and return it to neurons in the form of glutamine (Gln). Glutamate receptors on astrocytes (such as metabotropic glutamate receptors) sense synaptic glutamate release, which in turn induces a rise in Ca concentration in the astrocytes. One of the main functions of glia at the synapse is to maintain ion homeostasis, for example regulating extracellular K concentrations and p. H.
Development of NGS-pipeline for Complete Genome Sequencing: Schizophrenia and Alzheimer’s Disease Short reads Alignment Identification of SNP, short and large indels chromosomal rearangements Functional annotation of coding and regulatory variations Example: G 490 R substitution in DMRTA 2, Doublesex- and mab-3 -related transcription factor A 2, that may be involved in sexual development. Effect: Poly. Phen - probably_damaging SIFT - deleterious
This myth dates back at least as far as Aristotle, who in 335 BC wrote: "Of all the animals, man has the brain largest in proportion to his size”- Aristotle oc ne s c ar all ea os co pu w ho le vo br l. ain um or t vo ical l. gr ay Brain Size in Primates (Homo) and Proboscidea (Elephant) and the relative size of the corpus callosum brain-to-body ratio in human is huge compared to that of an elephant (about 1/40 versus 1/560, respectively) A- African elephant ~ 3890 cm 3 12. 8 cm 2 ~1379 cm 3 B - Human ~ 1450 cm 3 5. 99 cm 2 583 cm 3 C - Bottlenose dolphin ~1360 cm 3 2. 56 cm 2 463 cm 3 Hakeem et al. , Anat Rec A Discov Mol Cell Evol Biol. 2005 Nov; 287(1): 1117 -27
Inheritance of the Disease • Mitochondrial • Autosomal-Dominant • Autosomal-Recessive • X- Linked
Cell-based EPIGENOMICS in Human Brain prefrontal Neurons : Remarkably, in a past 5 -6 mln years of evolution of ancestral lineage of modern Homo sapiens (after its splitting with ancestrial chimpanzee lineage) the brain size is increased in threefold, but the size of the prefrontal cortex asdisproportionally increased sixfold. Chip-seq H 3 K 4 me 4 chromatin in human and primate brain neurons : Nuclei extraction and FACS of (A) Neu. N positive cells (neurons) and (B) Neu-N negative cells (non neuronal cells) in human brain tissues.
“The great gift of human being is that we have the power of empathy”Meryl Streep
1 Pushino 2014 4 2.ppt