Lect 11 Analysis and Cloning of Genomes 6

Lect 11: Analysis and Cloning of Genomes 6 th Ed: 9 -1, 9 -2, 9 -3, 9 -4, 10 -1, 18 -2, 18 -3, 18 -4 1

Basic techniques --- DNA sequence The array of nucleotides in a DNA molecule --- Restriction Enzymes These enzymes recognize and cleave DNA at specific sequences --- DNA cloning This allows the isolation and generation of a large number of copies of a given DNA sequence from a single individual --- Transformation Stably integrating a piece of DNA into the genome of an organism --- Nucleic acid hybridization complementary strands will associate and form double stranded molecules --- Blotting Allows analysis of a single sequence in a mixture of nucleic acids from a single individual --- PCR amplification (making many copies) of a known sequence --- Genetic engineering Altering the DNA sequence of a given piece of DNA --- Genomics Analyzing the entire genome OF INDIVIDUALS 2

Sequencing Genomic DNA Fragment DNA (clone) Sequence fragments ACGCGATTCA GATTCAGGTTACCACGCGAT GGTTA CCACGC TCA Align fragments Build consensus sequence 3

Sequencing Reference Genome- Number of donor DNAs are sequenced Pieces of DNA are sequenced many times Computers are used to overlap the pieces to generate contigs Consensus sequence is reference genome Sequences of individuals will vary from the reference genome ACGCGATTCAGGTTACCACGCGTAGCGCATTACAC Genome Reference ACGCGGTTCAGGTTACCACGCGTAGCGCATTACAC Individual 1 ACGCGATTCAGGTTACCACGCGTAGCGCATTACAC Individual 2 ACGCGATTCAGGTTACCACGCGTAAAACATTACAC Individual 3 ACGCGGTTCAGGTTACCCCGCGTAGCGCATTACAC Individual 4 The sequence homology between Individuals is not perfect!!! This allows us to assign a specific sequence to a specific Individual 4

Homology (molecular biology) Regions of the DNA (gene or non-gene) that share similar nucleotide sequence Sequence homology is a very important concept Structural homology (nucleotide sequence) implies functional homology Genes with a similar sequence are likely to function in a similar manner Variation in sequence between individuals is also very Important To determine the variation in sequence we could sequence the region of each individual or we can use other more rapid and cheap methods. 5

Restriction Enzymes What are Restriction enzymes What are restriction enzyme RECOGNITION sites in DNA How do we map Restriction enzyme sites in DNA How do we use restriction enzymes to clone pieces of DNA How do we use restriction enzyme sites/maps to study individuals Restriction enzymes have been isolated from bacteria. They serve a host-defense role. Foreign DNA from viruses will be chopped up and inactivated ("restricted") within the bacterium by the restriction enzyme. Question: Why don’t they chew up the genomic DNA of the bacteria. A bacterium that makes a specific restriction endonuclease also synthesizes a companion DNA methyltransferase, which methylates the DNA target sequence (usually at an A and sometimes at a C) for that restriction enzyme, thereby protecting it from cleavage by that restriction enzyme. 6

7

Restriction Enzymes which Recognize a SPECIFIC DNA sequence BIND that sequence and CUT the DNA at that specific sequence Sma. I is a Restriction enzyme | 5’ AAAACCCGGGAAAA 3’ 3’ TTTTGGGCCCTTTT 5’ | This sequence is symmetrical. If one rotates it about the axis It reads the same Eco. RI is another Restriction enzyme that recognizes the sequence and cuts the sequence (but not in the middle) | 5’ AAAAGAATTCAAAA 3’ 3’ TTTTCTTAAGTTTT 5’ | Some restriction enzymes recognize a specific sequence that is 4 bp long Some restriction enzymes recognize a specific sequence that is 6 bp long Some restriction enzymes recognize a specific sequence that is 8 bp long 8

Bam. HI Restriction enzyme digestion of DNA (linear genomic double stranded DNA) OR Restriction enzyme digestion of bacterial plasmid DNA (small double stranded circular DNA) No digestion of RNA No digestion of single stranded DNA Restriction enzymes

No digestion of RNA No digestion of single stranded DNA A linear DNA molecule with ONE Sma. I site will be cut into two fragments A circular DNA molecule with ONE Sma. I site will be cut into one fragment A linear DNA molecule with TWO Sma. I site will be cut into three fragments A circular DNA molecule with TWO Sma. I site will be cut into two fragment 10

Blunt Vs Sticky After digestion of DNA by a restriction enzyme the DNA ends are either blunt or sticky Blunt ends Sticky ends Sma. I- Cuts the DNA so the new ends of the DNA are flush (blunt) 5’AAAAAGGGGTTTTTTTCCCGGGAAAAGGGGTTTTTT 3’ 3’TTTTTCCCCAAAAAAAGGGCCCTTTTCCCCAAAAAA 5’ 5’AAAAAGGGGTTTTTTTCCC 3’ 3’TTTTTCCCCAAAAAAAGGG 5’ 5’GGGAAAAGGGGTTTTTT 3’ 3’CCCTTTTCCCCAAAAAA 5‘ Eco. RI is another commonly used restriction enzyme 5’AAAAAGGGGTTTTTTTGAATTCAAAAGGGGTTTTTT 3’ 3’TTTTTCCCCAAAAAAACTTAAGTTTTCCCCAAAAAA 5’ 5’AAAAAGGGGTTTTTTTG 3’ 3’TTTTTCCCCAAAAAAACTTAA 5’ 5’AATTCAAAAGGGGTTTTTT 3’ 3’GTTTTCCCCAAAAAA 5‘ Eco. RI produces sticky or cohesive ends (SINGLE STRANDED) These cohesive ends facilitate formation of recombinant DNA molecules

Recombinant DNA 5’AAAAAGGGGTTTTTTTGAATTCAAAAGGGGTTTTT 3’ 3’TTTTTCCCCAAAAAAACTTAAGTTTTCCCCAAAAA 5’ 5’AAAAAGGGGTTTTTTTG AATTCAAAAGGGGTTTTT 3’ 3’TTTTTCCCCAAAAAAACTTAA GTTTTCCCCAAAAA 5’ AATTCACGTACGTACGTG GTGCATGCATGCACTTAA 5’AAAAAGGGGTTTTTTTG AATTCAAAAGGGGTTTTT 3’ 3’TTTTTACCCCAAAAAAACTTAA GTTTTCCCCAAAAA 5’ 5’AAAAAGGGGTTTTTTTGAATTCACGTACGTACGTGAATTCAAAAGGGGGGG 3’TTTTTACCCCAAAAAAACTTAAGTGCATGCATGCACTTAAGTTTTCCCCA 12

Complementary sticky ends AATTCAAAAGGGG AAAAAAGGGGTTTTTTTG TTTTTTCCCCAAAAAAACTTAA GTTTTCCCCAAA 5’ AAAAAAGGGGTTTTTTTG AATTCAAAAGGGGTTT 3’ TTTTTTCCCCAAAAAAACTTAA GTTTTCCCCAAA 5’ GGCCCAAAAGGGGTT AAAAAAGGGGTTTTTTTG GTTTTCCCCAAA 5’ TTTTTTCCCCAAAAAAACTTAA

Enzyme compatibility Sma. I AAACCCGGGAAA TTTGGGCCCTTT Xma. I AAACCCGGGAAA TTTGGGCCCTTT AAACCC GGGAAA TTTGGG CCCTTT Eco. RI AAAGAATTCAAA Mfe. I TTTCTTAAGTTT AAACCCGGGAAA TTTGGGCCCTTT AAACAATTGAAA TTTGTTAACTTT AAAGAATTGAAA TTTCTTAACTTT Kpn. I Cant be cut by Eco. RI or Mfe. I AAAGGTACCAAA Asp 718 AAAGGTACCAAA TTTCCATGGTTT AAAGGTAC TTTC GTACCAAA GTTT

Sma. I AAAAAACCCGGGAAAAAA ---------TTTTTTGGGCCCTTTTTT Xma. I AAAAAACCCGGGAAAAAA ---------TTTTTTGGGCCCTTTTTT Eco. RI AAAAAAGAATTCAAAAAA ---------TTTTTTCTTAAGTTTTTT Mfe. I AAAAAACAATTGAAAAAA ---------TTTTTTGTTAACTTTTTT Kpn. I AAAAAAGGTACCAAAAAA ---------TTTTTTCCATGGTTTTTT Asp 718 AAAAAAGGTACCAAAAAA ---------TTTTTTCCATGGTTTTTT

xxxx 16

Using Restriction enzymes to Clone DNA How do we clone a fragment of DNA Or how do we clone a gene The construction of Recombinant DNA molecules or cloning of DNA molecules Recombinant DNA is generated through cutting and pasting of DNA to produce novel sequence arrangements Restriction enzymes such as Eco. RI produce staggered cuts leaving short single-stranded tails at the ends of the fragment. These “cohesive or sticky” ends allow joining of different DNA fragments When a piece of DNA is cut with Eco. RI, you get | nnn. GAATTCnnn nnn. CTTAAGnnn | nnn. G AATTCnnn nnn. CTTAA Gnnn 17

Recombinant DNA Restriction enzymes such as Eco. RI produce staggered cuts leaving short single-stranded tails at the ends of the fragment. These “cohesive or sticky” ends allow joining of different DNA fragments When a piece of DNA is cut with Eco. RI, you get | GAATTC CTTAAG | AATTCTTTTTTAAAAAAGAAT GAAAAAATTTTTTCTTAA AATTCAAAAAGGGGGTTTTTTTG TTAAGTTTTTCCCCCAAAAAAACTTAA 5’AAAAAGGGGTTTTTTTG AATTCAAAAAAAGGGGTTTTTTTG AATTCAAAAGGGGT 3’TTTTTACCCCAAAAAAACTTAA GTTTTTTTCCCCAAAAAAACTTAA GTTTTCCCCAAAAA 18

Plasmids are naturally occurring circular pieces of DNA in E. coli The plasmid DNA is circular and usually has one Eco. RI site. It is cut with Eco. RI to give a linear plasmid DNA molecule AATT 19

Plasmids Small circular autonomously replicating extrachromosomal DNA Modified plasmids, called cloning vectors are used by molecular biologists to isolate large quantities of a given DNA fragment Plasmids used for cloning share specific properties They have to be CIRCULAR Unique restriction site Antibiotic resistance Origin of replication E Bacterial genome Plasmid DNA (5000 kb) (3 kb) Origin Antibiotic resistance gene 20

Plasmid elements Origin of replication: This is a DNA element that allows the plasmid to be replicated and duplicated in bacteria. Each time the bacterium divides, the plasmid also needs to divide and go with the daughter cells. If a plasmid cannot replicate in bacteria, then it will be lost. 21

Plasmid elements Antibiotic resistance: This allows for the presence of the plasmid to be selectively maintained in a given strain of bacteria +antibiotics -plasmid +antibiotics +plasmid Lab bacterial strains are sensitive to antibiotics. When grown on plates with antibiotics, they die. The presence of a plasmid with the antibiotics resistance gene transforms these lab strains so they can grow on plates with the antibiotic. You are therefore selecting for bacterial colonies with the Plasmid. 22

Plasmid elements Unique restriction sites: For cloning the plasmid needs too be linearized. Most cloning vectors have unique restriction sites. If the plasmid contains more than one site for a given restriction enzyme, this results in fragmentation of the plasmid Why does this matter? Ori Antibiotic resistance gene 23

p. UC 18 is one of the most commonly used plasmid: p. UC= plasmid University of California Plasmid p. BR 322 p. UC 18 p. ACYC p. SC 101 replicon p. MB 1 p 15 A p. SC 101 copy No 15 500 10 5 24

Cloning DNA When a CIRCULAR piece of DNA is cut with Eco. RI you get stick ends | GAATTC CTTAAG | 5’AAAAAGGGGTTTTTTTGAATTCAAAAGGGGTTTTTT 3’ 3’TTTTTACCCCAAAAAAACTTAAGTTTTCCCCAAAAAA 5’ 5’AAAAAGGGGTTTTTTTG AATTCAAAAAAAGGGGTTTTTTTG AATTCAAAAGGGGTTT 3’TTTTTACCCCAAAAAAACTTAA GTTTTTTTCCCCAAAAAAACTTAA GTTTTCCCCAAAAAA 5 When two pieces of DNA cut with Eco. RI are ligated back together you get back an Eco. RI site ---------G ---------CTTAA AATTC---------G G---------CTTAA AATTC------- G---- 25

Cloning Ampr The genomic DNA is Cut with a restriction enzyme A plasmid is linearized by cutting with a restriction enzyme The cut genomic DNA and plasmid are mixed together Genomic DNA Ori Both the plasmid and genomic DNA have been cut with a restriction enzyme so that they have complementary sticky ends | G A A T T C C T T A A G | --------TTAA AATT-------- Genomic DNA AATT 26

PLASMID AA TT Ligation AATT The Eco. RI linearized PLASMID DNA is mixed with foreign (yeast, human etc) DNA digested with Eco. RI The sticky ends will hybridize/anneal specifically and a recombinant plasmid will be generated --------TTAA AATT-------- Genomic DNA AATT 27

Recombinant plasmid This process where foreign genomic DNA is joined to plasmid DNA is called ligation It results in recombinant plasmid (foreign DNA+plasmid) Each plasmid has one foreign Eco. RI fragment Each foreign fragment is still present as only one copy! This is 28 not useful.

Incompatibility of sticky ends Plasmid cut with Eco. RI --------TTAA AATT-------- Genomic DNA | G A A T T C C T T A A G | AATT Genomic DNA cut with Eco. RI Genomic DNA cut with Hin. DIII AGCT------------- --------------TCGA Genomic DNA --------TCGA AATT AGCT--------- | A A G C T T C G A A | AATT DOES NOT WORK!!! 29

Transformation The plasmids bearing genomic DNA inserts is called a Genomic Library! These plasmids are added back into bacteria by a process called transformation Ampr Ge ne Ori Ampr The bacteria are selected for the presence of the Plasmid by growth on media containing antibiotics Ge ne Ori Petri dish + antibiotic Each colony of E. coli will harbor one plasmid with one piece of genomic DNA. Only cells with plasmid will grow on plates with antibiotics (the antibiotic resistance gene on plasmid allows these 30 cells to grow). Cells that did not take up a plasmid will not grow.

Plasmid propagation The plasmid DNA can replicate in bacteria and therefore many copies of the plasmid will be made. The human DNA fragment in the plasmid will also multiply along with the plasmid DNA. THE DNA IS CLONED Normally a gene is present as 2 copies in a cell. If the gene is 3000 bp long there are 6 x 103 bp in a total of 6 x 109 bp of the human genome Once ligated into a plasmid, unlimited copies of a single gene can be produced. The process of amplifying and isolating the human DNA fragment is called DNA cloning. 31

Why are plasmids important? Most genes are present as two copies in the entire genome. Plasmids allow us to obtain 1000’s of copies of a gene in a pure form 32

xxxx 33

Types of clones What are genomic clones What are c. DNA clone What is a PCR clone of a specific gene

Genomic clones Genomic DNA Digest Genomic DNA and plasmid with restriction enzyme Ligate genomic DNA and plasmid DNA Transform into E. coli and Grow individual plasmid colonies

Genomic Libraries Gene 1 A Gene 2 B C Gene 3 D E Each fragment is ligated into the plasmid Each plasmid is put (transformed) into E. coli Each E. coli colony on a plate has one specific plasmid All plasmids together make up a genomic library D C A B E 36

Genomic clone libraries Species Genome size average insert size #plasmids E. Coli Drosophila Human 5000 kb 150, 000 kb 3000, 000 kb 16 kb 1300 46, 000 >100, 000 An entire genome of any organism can be cloned as small fragments in plasmids The larger the genome, the more difficult the task At present, genomic DNA libraries exist for a large number of organisms including Yeast, C. elegans, Drosophila, Zebrafish, Xenopus, Chickens, Mouse, Humans etc 37

RNA Cannot be cloned c. DNA clone So to clone RNA, you first convert RNA into DNA Reverse transcriptase copies RNA into DNA This DNA (c. DNA) is an complementary copy of the RNA (RNA was the template) The c. DNA is then cloned into plasmids

c. DNA Often we have RNA rather than DNA as the starting material For instance if you isolate RNA from blood cells, most of the RNA is globin RNA. The enzyme reverse transcriptase has proven very useful to molecular biologists. This enzyme catalyzes the synthesis of DNA from a RNA template. It is normally found in a large class of viruses. The genome of these viruses is RNA!! These retroviruses infect eukaryotic cells and use these cells to grow/replicate Retroviruses carry an RNA genome. Interestingly they will integrate into the DNA of the host. For RNA to integrate into DNA, first the RNA has to be converted to DNA Remember the central dogma of molecular biology Information flows from DNA to RNA to protein! DNA---->RNA---->protein Reverse Transcriptase reverses this dogma (partially) 39

c. DNA synthesis Protein coat RNA genome Reverse transcriptase m. RNA DNA RT DNA c. DNA 40

c. DNA/splicing So from globin m. RNA, a complementary DNA molecule can be created using reverse Transcriptase. This complementary DNA is called c. DNA. The c. DNA can now be inserted into a plasmid and cloned. What is the relationship between a c. DNA clone and a genomic clone? Splicing In eukaryotes, the coding sequences are interrupted by introns 1 2 3 4 5 Gene 7700 nt 6 7 Ovalbumin Primary transcript Splicing m. RNA 1872 nt 41

c. DNA library Gene 1 B Gene 2 C Gene 3 D E Primary Transcript m. RNA (Spliced) c. DNA clones 42

Genomic Vs c. DNA Genomic clones represent the organization of the DNA in the nucleus! c. DNA clones represents the organization of m. RNA sequences after the gene has been transcribed, processed and exported to the cytoplasm. c. DNA clones contain the sequence of nucleotides that code for the m. RNA--protein! c. DNA clones do not contain the sequence of the promoter of the gene or the intron. The starting material for c. DNA clones is different from material used to make genomic clones Genomic clone c. DNA clone Source Nucleii (any cell) cytoplasmic RNA (specific cell type) Use Studies on gene organization & Studies directed towards coding regions structure 43

PCR It’s a method that can be used to make many copies of a particular DNA sequence from a particular individual You have to know the DNA sequence before you can amplify that sequence (it does not have to be cloned) The sequence will not propagate (replicate) in living organisms 44

PCR Heat 95 C to denature DNA and add primers Let Primers hybridize to DNA (55 C) Add Heat resistant DNA polymerase and d. NTP (70 C) Repeat- 95 C 55 C 70 C 45

Repeat- 95 C 55 C 70 C 46

PCR Exponential Amplification

5’AAAGATCGGTTGGGGGGTCGATCTA 3’ 3’TTTCTAGCCAACCCCCCAGCTAGAT 5’ PRIMER 1 5’AAAGATC 3’ 3’AGCTAGAT 5’ PRIMER 2 5’AAAGATCGGTTGGGGGGTCGATCTA 3’ 3’AGCTAGAT 5’ 5’AAAGATC 3’ 3’TTTCTAGCCAACCCCCCAGCTAGAT 5’ 5’AAAGATCGGTTGGGGGGTCGATCTA 3’ 3’TTTCTAGCCAACCCCCC AGCTAGAT 5’ 5’AAAGATC GGTTGGGGGGTCGATCTA 3’ 3’TTTCTAGCCAACCCCCCAGCTAGAT 5’ 48

PCR 3 PCR 2 PCR 1 How do you detect PCR? Agarose Gels Size of PCR product will depend upon location of PCR primers 49

PCR clone PCR cloning IF YOU KNOW THE SEQUENCE OF THE GENE YOU WANT TO CLONE You can use PCR to first make many copies of your gene Then you cut the PCR fragment and plasmid with a restriction enzyme Ligate PCR amplified DNA fragment with plasmid, transform E. coli Then you can clone those copies into a plasmid.

xxxxx 51

Applications for cloned DNA pieces Sequencing cloned DNA Mutagenizing cloned DNA at a specific site Expression of foreign genes- synthetic biology Studying regulation of gene expression Generating probes for FISH, southern blotting etc 52

Cloning and Gene Editing Generating probes for FISH, southern blotting etc Studying regulation of gene expression Expression of foreign genes- synthetic biology Where can you do this? Adult Somatic cells Stem cells Embryos What can you do? Express Foreign gene Restore Normal gene Delete gene How do you do this? Molecular genetics 53

Expression of genes in E. coli You need: Coding region of protein + Promoter, Enhancer, Ribosome binding site, transcription terminator Bacterial Gene = ENHnnnnn//nnnn. TATAAAnnnnn. RBSnnnn. ATGGGACCGAGGTAAnnnnn. TERnnnnn ENHnnnnn//nnnn. ATATTTnnnnn. RBSnnnn. TACCCTGGCTCCATTnnnnn. TERnnnnn To Express Yeast protein in E. coli you need to replace bacterial protein sequence with yeast protein sequence ENHnnnn//nnnn. TATAAAnnnnn. RBSnnnn. ATGAAAGGGCCCTTTAGCTAAnnnnn. TERnn nnnnn ENHnnnn//nnnn. ATATTTnnnnn. RBSnnnn. TACTTTCCCGGGAAATCGATTnnnnn. TERnnn nnnn No cloning of RNA into double stranded plasmid DNA No cloning of single stranded DNA into plasmid DNA

Yeast RBS Yeast TATA Yeast ENH ATGAAAGGGCCCTAA Yeast Protein Yeast TER Hin. DIII Eco. RI NDEI Eco. RI Hin. DIII Yeast Gene- coding region 55

First clone Coding region H N B Yeast gene coding region (eliminate yeast promoter) Use a Plasmid that will propagate in E. coli N N H B

N N H B K E. Coli plasmid with Yeast gene E. Coli promoter Promoter cloning N N H K Hybrid Gene Construct

Terminator cloning H H E. coli Terminator N N H H K Hybrid Gene Construct This allows the expression of a yeast protein in E. coli 58

Definition of Key Terms Traditional breeding Conventional cross breeding of two species of plants to transfer a gene from one species to the other (sexually compatible) Cisgenics Genetic modification of a recipient plant/animal with a gene from the same or a sexually compatible plant/animal species Transgenics Genetic modification of a recipient plant/animal with a gene from a sexually incompatible plant/animal or other organism 59

Foreign gene expression What if you want to express Influenza antigen (protein) in butterfly cells? Influenza virus promoter sequences do not work in butterfly cells Connect Influenza antigen coding region to a butterfly enhancer/promoter in E. coli on a plasmid Butterfly Enhancer Butterfly Promoter Influenza Gene Coding region 60

Mixing and matching Hin. D Blood specific Enh/prm 5’UTR Hin. D Coding region GLOBIN gene 3’UTR ori Kanr Hin. D Liver specific Enh/Prm ori Kanr Hin. D Globin Expression in liver 61

Isolate the plasmid To isolate the gene fragment, we grow up a large population of E. coli containing the plasmid with the gene insert. A simple procedure allows us to isolate the plasmid (which is smaller than Chromosomal DNA) Once we have purified the plasmid we have 1000’s of copies of Gene in a plasmid 62

Gene transfer of foreign and plasmid DNA CF gene on a plasmid CF+ Isolate Plasmid Transfect human cell with CF+ plasmid Human Cell is cf-/cf. It becomes CF+ after transfection 63

CRISPR System 64

CRISPR System 65

CRISPR 66

CRISPR 67

Figure 1 Trends in Plant Science DOI: (10. 1016/j. tplants. 2015. 04. 011)

Reintroducing WT gene- Traditional breeding Ancient corn x Small cob Large height Insect resistant Slow growth Easily stressed commercial corn large cob short height insect sensitive rapid growth stress resistant Parent 1 x Parent 2 (start with ~1000 crosses) F 1 Phenotype selection (500, 000 plants) F 2 (50, 000 plants) F 3 (asses using markers) F 4 (5000 plants) F 5 (1000 plants- check yields, other traits) F 6 (5 plants- submit for official trials) (You may bring along undesired linked genes along with 69 trait desired)

Triticale: GMO? Attempts to cross wheat and rye produced sterile offspring. New techniques were developed that allowed production of fertile hybrid. The two plants were treated with a potent toxin colchicine The mutagenesis allowed the genome of wheat and rye (these are different species) to overcome species barriers, fuse and form a NEW SPECIES !! These plants were used to develop genetically novel plants with traits from wheat and rye parents producing a “Super. Food” called Triticale- it’s a allo tetraploid (diploid wheat+diploid rye). You can buy it at health food stores! 70

Reintroducing WT gene- Cisgenics Ancient native corn (roots) emit a volatile substance, bcaryophyllene, when attacked by insects. The substance attracts nematodes to the roots. These worms eat the insects protecting the corn. Commercial corn has a mutation and cannot produce bcaryophyllene. The wild type gene b-caryophyllene synthase was cloned. A commercial corn plant was transformed with the wild type gene -b-caryophyllene synthase on a plasmid. The marker gene (foreign gene) on the plasmid was used to select for transformed plants. The transformed plants could now produce b-caryophyllene and were resistant to insects. 71

Cisgenics : CRISPR in Somatic Cells Genome editing to correct mutations in adult cells Genome editing to repair faults in human adult cells. To restore the production of the dystrophin protein in muscle cells. In a study conducted by researchers at Duke University, muscle precursor cells were extracted from people affected by Duchenne muscular dystrophy and cultured in the laboratory. Dystrophin production was restored using genome editing techniques and implanted back into the muscle tissue of mice. The cells were able to resettle and make human dystrophin protein. Researchers used CRISPR/Cas 9 -mediated genome editing, to precisely remove a mutation in DNA, allowing the body’s DNA repair mechanisms to replace it with a normal copy of the gene. The benefit of this is that it can permanently correct the “defect” in a gene rather than just transiently add a “functional” one, Using CRISPR/Cas 9, the team was able to correct the genetic defect in mice and prevent the development of features of the disease, which causes progressive muscle weakness and degeneration, often along with breathing and heart complications. 72

Cisgenics : Deleting genes- Cisgenics Ethylene gas released by fruit accelerates the ripening process. Prevention of ethylene production would block the fruit from ripening prematurely and spoiling on the way to the market. The ethylene biosynthetic pathway is as follows: Precursor----->ACC------>ethylene ACC synthase oxidase Technology was used to generate mutants in the plant so that they could not synthesize the enzymes required for ethylene gas production. 73

CRISPR in Embryos In the process of domestication and breeding modern varieties, Specific genetic traits have been lost, and that is why breeders routinely go back to wild relatives to find that genetic variation. Reinstating genes lost during domestication can make crops tougher and provides an alternative to using foreign genes to modify plants. New techniques that tinker with DNA, swapping in genes from undomesticated relatives without selection, can make crops more similar to their original wild versions. Genome editing in human embryos Although genome editing has been extensively studied in human adult cells and animal embryos, it has recently been tried in human embryos for the first time. A research paper published by Chinese scientists showed that using genome editing to change the genome of human embryos was possible though it was highly inefficient. 74

Expressing foreign genes in yeast- Transgenics Malaria is treated with a drug – Artemisinin In nature, artemisinin is produced by the plant Artemisia annua. The global supply of artemisinin comes almost exclusively from farmers that cultivate the plant. However, the global supply of artemisinin is highly volatile because of the uncertainty associated with crop success. The Keasling lab at UC Berkeley wanted to provide a cheap and reliable alternative to agricultural production. This required engineering an entire non-native metabolic pathway into yeast cells. They expressed the genes required for the production in yeast cells and generated the compound in yeast. 75

Expressing a foreign gene in plants/animals- Transgenics A species of bacteria produces a natural pesticide The gene necessary for producing the toxin was identified and cloned from the bacterium The gene was inserted into the genome of plants. This bacterial gene was now able to replicate in plants and the plant made and secreted the toxin. The plant now produced the toxin thus eliminating the need for pesticide spraying. This reduces the harmful effects of pesticides on humans However, insects start becoming resistant to this toxin. 76

Problems with cloning Safety. Toxicity: DNA Vs protein product Introducing Genes. Somatic cells Procedure of introducing genes itself might cause problems Novel Genetic Interactions between foreign gene product and endogeneous genes (Cisgenics Vs Transgenics) Embryonic cells Propagation to progeny Horizontal gene transfer to other organisms Deleting Genes Loss may affect unrelated processes/pathways in cell and be deleterious Introduction of foreign marker gene to select cells with deletion 77

The Future The aurochs was the wild ancestor of modern cattle. With large horns and great strength, it inspired awe and fear until it went extinct in 1627. A new generation of biologists has been trying to back-breed a replica by combining traits from various heritage cattle. Analysis of DNA from aurochs will help guide and speed up the process. Already they are establishing herds of aurochs like cattle in various countries as part of an ambitious effort to rewild abandoned farmland nature reserves in Europe. A second option is cloning. Scientists would take a preserved cell from a recently extinct animal and extract the nucleus. They would then swap this nucleus into an egg cell from the animal’s closest living relative and implant the egg into a surrogate host. (Researchers actually did this in 2007, and a common goat gave birth to an extinct species, the Pyrenean ibex. The infant lived only 7 minutes however, because of genetic problems with its lungs. ). We’ll be restricted to animals that went extinct more recently and have well-preserved cells with intact nuclei. The mammoth and the passenger pigeon may never be cloned. The newest option is genetic engineering. Here, researchers would line up the genome of an extinct animal with that of its closest living relative. They would then use CRISPR and other gene-editing tools to swap relevant genes from the extinct animal into the living species and implant the hybrid genome into a surrogate. This approach doesn’t produce genetically identical copies of extinct animals, but rather modern versions of an animal engineered to look and behave like its extinct relatives. This is the technology being used by the mammoth 78 and passenger pigeon groups.

Trititcale- created in the 1880’s-1930’s by the Edinburgh Botanical Society. Using chemical mutagenesis combined with Mendelian crosses. Is it a good idea to mutate crops using chemical mutagens? Flavor Savr tomato helps transport fragile food preventing waste. Labeled a Frankenfood. It has a single mutation in one gene. Is it a good idea to mutate crops using recombinant DNA methods? What if you made the same mutation by classical genetics? Reinserting Caryophyllene synthase into corn restores its natural insect resistance which was lost when commercial corn varieties were generated by classic breeding techniques. What if you inserted this gene back by genetic crosses? Bt cotton created in the 1990’s using recombinant DNA and transgenic technology. What if you inserted a gene from one species in to another species using classical genetics? Gene blocking may produce tea, coffee without the caffeine, Tomatoes with a higher antioxidant (lycopene) content, Fungal resistant bananas, Smaller, seedless melons for use as single servings, Bananas and pineapples with delayed ripening qualities http: //www. nytimes. com/2013/03/19/science/earth/research-tobring-back-extinct-frog-points-to-new-path-andquandaries. html? pagewanted=all 79 Message: Understand the differences (GM-foods) pre- and post 1990

Genome sequencing Whether bacterium or human, the genome of any organism to too large to be deciphered in one go. The genome is therefore broken into smaller pieces of DNA, each piece is sequenced and computers fit all the sequences back together. The human chromosome to be sequenced. The chromosome is first chopped randomly into conveniently sized chunks. These large fragments are inserted into bacterial artificial chromosomes (BACs) and cloned in bacteria. These fragments are then mapped so it is known which region of the chromosome they came from. Each BAC is shotgunned - broken randomly into many small pieces. This process is repeated several times to give different sets of fragments. (The whole-genome shotgun method goes directly to this stage. ) The fragments are cloned in small vectors and then sequenced. About 500 bases of sequence information is produced from each fragment. The sequences are fed into a computer, which looks for overlaps at the end of the sequence to find neighbouring fragments. When many fragments have been sequenced the sequence of the original BAC insert can be assembled. The process is carried out for all the BACs to give a complete chromosomal sequence. For example, the human genome is about 3 billion base pairs, arrayed in 24 chromosomes. The chromosomes themselves are 50– 250 million bases (megabases) long. These tracts of DNA are much too large for even the latest automated machines, which sequence fragments of DNA between 400 and 700 bases long. The genome is first broken into conveniently sized chunks, fragments of about 150 kilobases. Each fragment is inserted into a bacterial artificial chromosome (BAC), a cloning vector used to propagate DNA in bacteria grown in culture. The BACs are then mapped, so that it is known exactly where the inserts have come from. This process makes re-assembling the sequenced fragments to reflect their original position in the genome easier and more accurate, and any one piece of human DNA sequence can automatically be placed to an accuracy of 1 part in 30 000. Each of the large clones is then 'shotgunned' - broken into pieces of perhaps 1500 base pairs, either by enzymes or by physical shearing - and the fragments are sequenced separately. Shotgunning the original large clone randomly several times ensures that some of the fragments will overlap; computers then analyse the sequences of these small fragments, looking for end sequences that overlap - indicating neighbouring fragments - and assembling the original sequence of the clone. An alternative approach, 'whole genome shotgun sequencing', was first used in 1982 by the inventor of shotgun sequencing, Fred Sanger, while working on phages (viruses of bacteria). As its name suggests, in this technique the whole genome is broken into small fragments that can be sequenced and reassembled. This method is very useful for organisms with smaller genomes, or when a related genome is already known. 80

Animal cloning Animal clones are genetically identical. Natural clones occur in the form of identical twins but it is also possible to produce artificial clones by nuclear transfer. The nucleus is removed from a somatic (body) cell and placed in an egg whose own nucleus has been removed. The egg is then implanted in a surrogate mother and develops to term. Key principles * Differentiated animal cells are unable to develop into complete animals *The nuclei of most differentiated cells retain all the necessary genetic information. * Transfer such a nucleus into an egg whose own nucleus has been removed. * Transfer to the environment of the egg reprograms the nucleus (makes it forget its history) and allows the full development of a viable animal that is genetically identical to the donor of the somatic cell. * Until 1997, cloning in mammals was only possible using nuclei obtained from very early embryos. A breakthrough was made when cloning was achieved using nuclei from adult cells. * Recent research suggests that animals produced by cloning from adult cells may age prematurely, but further investigation is necessary. How does it work? Nuclear transfer is carried out by fusing the donor somatic cell to an egg whose own nucleus has been removed. Fusion is achieved in a culture dish by applying an electric current. The change in electrical potential also mimics the normal events of fertilisation and initiates development. A key aspect in the success of nuclear transfer is synchronisation of the cell cycles between the donor nucleus and the egg. Before fertilisation, the egg's nucleus is quite inactive. The nucleus of the donor cell must also be made inactive otherwise it will not be reprogrammed and development will fail. Inactivation is achieved by culturing the cell but starving it of essential nutrients. The cell stops dividing and enters a quiescent state compatible with nuclear transfer. How is it used? Animal cloning has the potential to overcome the limitations of the normal breeding cycle. In the future, it may be used to produce elite herds by cloning the superior animals, or to rapidly produce herds of transgenic or otherwise modified animals. Transgenic farm animals make useful bioreactors, producing valuable proteins in their milk. Another application is the use of genetically-modified pigs as a source of organs suitable for transfer to humans (xenotransplantation). 81

xxxxxx 82

How is a specific gene isolated (CLONED)? Its like going to the library and looking for a specific book. It involves screening through a genomic library. A genomic library is a large collection of plasmids containing pieces of DNA from a specific species. The set of cloned fragments is so comprehensive that virtually the entire genome is represented in the library. The fragments that make up the library are initially generated by digesting genomic DNA (e. g. human) with a restriction enzyme- say Eco. RI The Eco. RI sites are randomly distributed in the genomefragments of varying lengths will be generated. Some fragments will contain one gene, others two genes or cut genes in half. Gene 1 A Gene 2 B C Gene 3 D E F 83

Gene 1 A Gene 2 B C Gene 3 D E F Each fragment is cloned into the plasmid, each plasmid is put (transformed) into E. coli C D A B 84

The library is random! Each fragment is cloned into the plasmid, each plasmid is put (transformed) into E. coli C D A B Gene 1 A Gene 2 B C Gene 3 D E F 85

Fragments, bookmark, title The library is not bookmarked or even titled and is in fragments! There is no organization to the library. It is simply a populations of cloned fragments representing the entire genome. The equivalent of this would be if you went to the University Library to find all the books in a large heap, the books had no title, and in addition instead of entire books you often found parts of books. How do you use such a library? How do you find the book you are interested in. Lets work our way through this problem with a simple example Organism has EIGHT genes in its genome A B C D E F G H Eco. RI 86

Genomic library If we wanted to study gene CCreate a restriction map of gene C Determine it sequence Study protein. C What do we need to do We need to initially clone the gene and make many copies of gene C Creating a genomic library provides a means of obtaining many copies of gene C To generate a genomic library: Total genomic DNA is isolated from the species of interest The DNA is cut with Eco. RI A A B C D b E d b C d E F F G G H h h 87

Genomic library These genomic DNA fragments are mixed with a plasmid that has been linearized at a single Eco. RI site (say p. UC 18) b d Ampr Ori F G h h d Ori Ampr C Ampr b E Ampr A Ori Both the plasmid and genomic DNA have been cut with Eco. RI, they have complementary sticky ends | G A A T T C C T T A A G | 88

Recombinant plasmid This process where foreign DNA is joined to plasmid DNA is called ligation It results in recombinant plasmid (foreign DNA+plasmid) Each plasmid has one foreign Eco. RI fragment Each foreign fragment is still present as only one copy! This is not useful. A b d E F G h h b C d 89

How are genomic libraries used? If we are interested in studying gene C, you need the plasmid containing gene C Having a genomic library means you have gene C, but where is it? Which colony on the Petri dish contains gene C? Genomic libraries are much more complex than the one described for our hypothetical 8 gene organism You need to identify one recombinant plasmid out of 100, 000’s present in a library. Identifying and isolating a specific plasmid is called screening a library. This requires a probe A probe is a sequence complementary to PART of the sequence one wishes to pull out. You radiolabel the probe and once labeled the probe is used to identify the plasmid containing E. coli colony How do we get the probe? 90

The genomic library and a specific probe enabled us to achieve two goals Out of the billions of base pairs in a large genome, we have been able to identify a few 1000 base pairs that correspond to a specific gene of interest. In addition we were able to isolate this sequence on a specifically engineered plasmid That allows us to make large quantities of this rare sequence. Genomic libraries are described in terms of average fragment size and the number of plasmids that must be screened to have the entire genome represented To have a good probability (>99%) of identifying a given DNA sequence (gene) present in the collection of plasmids (library). The number of plasmids (colonies) that must be screened is a function of the size of the genome of the species from which the Library was constructed. 91

92

Mt DNA Y chromosomes can be used to study paternal lineage mt. DNA can be used to follow maternal lineage Cells contain organelles- Mitochondria are organelles that produce Energy. They contain a small 17, 000 bp circular DNA. It encodes for 13 proteins in human cells and some t. RNA’s Hypervariable region (150 bp) t. RNA Cytochrome. B NADH dehydrogenase cytochrome. C oxidase ATP synthase Mitochondrial DNA inheritance is not mendelian It is inherited maternally 93

Using DNA to study History This hypothesis was initially derived from restriction maps of mitochondrial DNA Australia Europe Asia Africa “Eve’s DNA” 94 All humans are derived from a small African population about 170 K yrs ago

Eve Geographic region DNA A Mutation generates B from A. Now you have individuals With A and B DNA in population. C B A D C E C F B A D G C migrates to form a separate population. Additional mutations diversify DNAs in populations. Original population more diverse than newer population Compared sequences of mt. DNA There are greater sequence differences among Africans than any other group (Europeans, American Indians, Asians, etc) 95 The african population had the longest time to evolve variation And thus humans originated in Africa

xxxxxx 96