Скачать презентацию Introduction to DNA microarrays DTU — January 2007 Скачать презентацию Introduction to DNA microarrays DTU — January 2007

1baad8a938d04406580778c26bb0950a.ppt

  • Количество слайдов: 21

Introduction to DNA microarrays DTU - January 2007 - Hanne Jarmer Introduction to DNA microarrays DTU - January 2007 - Hanne Jarmer

Microarrays - The Concept Measure the level of transcript from a very large number Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go CELL RNA

Why? RNA Why? RNA

How? gene m. RNA gene specific DNA probes labeled target How? gene m. RNA gene specific DNA probes labeled target

Microarrays - The Technologies Stanford-type Microarrays High-density Microarrays - The Technologies Stanford-type Microarrays High-density

Stanford-type Microarrays Stanford-type Microarrays

Stanford-type Microarrays Coating glass slides Deposition of probes Post-processing Hybridization Stanford-type Microarrays Coating glass slides Deposition of probes Post-processing Hybridization

Spotting - Mechanical deposition of probes Spotting - Mechanical deposition of probes

16 -pin microarrayer 16 -pin microarrayer

Microarrayer Microarrayer

Stanford microarrays CONTROL SAMPLE m. RNA c. DNA Cy 5 -c. DNA Cy 3 Stanford microarrays CONTROL SAMPLE m. RNA c. DNA Cy 5 -c. DNA Cy 3 -c. DNA

® Gene. Chip Affymetrix oligonucleotide array • 11 to 20 oligonucleotide probes for each ® Gene. Chip Affymetrix oligonucleotide array • 11 to 20 oligonucleotide probes for each gene • On-chip synthesis of 25 mers • ~20, 000 genes per chip • good quality data • 280 -500 K features to play with

Photolithography in situ synthesis T A T T T A A T Mask #2 Photolithography in situ synthesis T A T T T A A T Mask #2 Mask #1 T A A T T T A AA A Spacers bound to surface with photolabile protection groups

Sample Preparation - Eberwine SAMPLE 42 °C 2 h + Reverse Transcriptase 16 °C Sample Preparation - Eberwine SAMPLE 42 °C 2 h + Reverse Transcriptase 16 °C 2 h RNA + RNase H + Polymerase 37 °C 6 h ss. DNA T 7 70 °C 10 min T 7 pol clean up ds. DNA + Biotin-labeled nucleotides a. RNA

Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) anti-SAPE Ig. G biotinylated Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) anti-SAPE Ig. G biotinylated anti-anti Ig. G

The Affymetrix Gene. Chip® A gene is represented like this: PM MM - Perfect The Affymetrix Gene. Chip® A gene is represented like this: PM MM - Perfect Match (PM) - Mis. Match (MM) PM: CGATCAATTGCACTATGTCATTTCT MM: CGATCAATTGCAGTATGTCATTTCT

Nimble. Gen • 385, 000 to 2. 1 mill features • Long probes (up Nimble. Gen • 385, 000 to 2. 1 mill features • Long probes (up to 70 nt) • Service: -labelling -scanning -image analysis

Photolithography - Micromirrors Photolithography - Micromirrors

Tiling arrays are used for determation of genes, nc. RNAs, TF-binding sites, . . Tiling arrays are used for determation of genes, nc. RNAs, TF-binding sites, . . .

The DNA Array Analysis Pipeline Question Experimental Design Array design Probe design Sample Preparation The DNA Array Analysis Pipeline Question Experimental Design Array design Probe design Sample Preparation Hybridization Buy Chip/Array Image analysis Normalization Expression Index Calculation Comparable Gene Expression Data Statistical Analysis Advanced Data Analysis Clustering PCA Classification Promoter Analysis Meta analysis Regulatory Network