In o to tr ch What do you

In o to tr ch: What do you think Biotechnology is? iote B What are some applications of biotechnology? What are the impacts and ethics of biotechnology? (a) Tobacco plant expressing a firefly gene (b) Pig expressing a jellyfish gene

Biotechnology A little of this, a little of that (C. 14. 3, 15. 2, 15. 3)

Genetic Ethics Quiz What would you do? A biotechnology company has spliced together genes from two different species of fish to produce salmon that grow faster. This allows the fish to be ready for purchase more quickly, decreasing consumer costs and increasing the availability of salmon. Will you: GMO Salmon a) b) c) Wait in line for the first genetically modified salmon. It sounds super yummy! Wait for further research to analyze the potential environmental and health impacts of GMO salmon Boycott any store willing to sell the salmon. Don’t trust what isn’t natural!!

You’ve found out that the child you (or your wife) carries has the gene for dwarfism. A new therapy exists that may repair this gene before the child is born. What do you do? a) Allow the child to be born with the gene, and we will accept the child as is. b) Attempt the new therapy to repair the gene. c) Terminate pregnancy. New Hope for Gene Therapy. . . A Young Boy's Fight Against Blindness

An agricultural company has found a way to make tomatoes 50% larger by splicing elephant genes into the tomatoes. Will you: a) Buy the tomatoes and have no problem eating them b) Probably not buy or eat the tomatoes. c) Protest the company. It’s not right to fool with mother nature!

Pet cloning is now available at the local mall. You used to have a pet dog named Charlie, but he died two years ago. Now you learn that you can get a new Charlie by just bringing in a sample of his hair. What do you do? a) Find a strand of Charlie’s hair as soon as possible. Can’t wait to see Charlie again! b) Let sleeping dogs lie. (Don’t clone Charlie)

Your Dog has just Died and you want to save his cells for Cloning Important! Please read below and act now! If your dog has just passed then you must act quickly as in right now! There is a 5 day window to successfully extract good quality cells from your beloved friend before the cells begin to deteriorate. This means that once your dog has passed the body will begin to quickly deteriorate and your chances of extracting quality cells diminishes with every passing day. Warning!!! Do not place your dog in the Freezer. If you do there will be zero chance of cloning your dog. You must wrap your dogs entire body with wet bathing towels and place it in the Refridgerator to keep it cool. Do this first and then call us right away. Time is of the essence! http: //myfriendagain. com/

A company can now create test tube babies according to parent specifications. The company can make sure that your child has all the traits you desire- hair color, intelligence, athletic ability, etc… What do you do? a) Sign me up, I want my child to be perfect. b) I’d rather let nature take its course. c) We might adjust some things to make sure the child is healthy (and has no genetic abnormalities).

Cloning technology is perfected. A clone can be made from adult tissue samples. You learn that you need a kidney transplant, but there are no donors available. A doctor suggests that you make a clone of yourself, so that the kidney would be a perfect match. What do you do? a) One is enough of me, I’ll wait for a donor. b) Clone myself, two is better than one.

A government organization is proposing to have all citizens of the US submit a sample of their hair so that their DNA can be scanned and kept on file. Each person’s DNA would be kept in a national database so that police could access the DNA when a crime was committed. Do you? a) Support this legislation b) Oppose this legislation c) Suggest the legislation be modified, only people with criminal records should be scanned.

An insurance company is requiring individuals to get genetic testing performed to determine whether they have a higher risk of heart disease, cancer, or other diseases. They are requiring that all people wanting health insurance be tested. What do you do? a) Find another insurance company, that information is none of their business. b) Submit my DNA for a test, I’d like to know anyway. c) File a lawsuit against the company.

What is Biotechnology? • Using cellular and biomolecular processes in the production of agricultural, medicinal, industrial, or other products. – Usually involves manipulation of DNA

What are some current applications/uses for biotech? • • • Transgenic organisms: plants, animals GMOs: genetically modified organisms. Reproductive Cloning Stem Cell Research (Therapeutic Cloning) Forensics Diagnosis of genetic disease Human Gene Therapy Pharmaceutical Products Evolutionary relationships

How does Biotechnology Work? Scientists must be able to manipulate DNA to serve various purposes. • Manipulation may include: - Gene identification Cutting DNA Amplifying/Copying DNA segments Separating and visualizing DNA fragments Inserting DNA into living cells …. . so how do we do this? ? ?

Cutting DNA! • Restriction Enzymes: – Enzymes that separate (“cut”) the DNA backbone (sugar-phosphate bond) between very specific DNA bases • Each RE has its own recognition sequence – Enable scientists to be very specific in the sequences they cut (specificity) – Uses: Disease diagnosis, DNA profiling, Transgenic organisms, etc.

Diagnosis of Disease: a mutation within a recognition sequence can be used to identify the presence of a disordered allele

How do we see DNA? • DNA is colorless and tiny! • Gel electrophoresis is a technique that uses electricity and a sponge-like substrate to separate DNA fragments by size – DNA is negatively charged…moves towards positive electrical pole – Large DNA fragments travel slower than small fragments

Steps to genetic marker analysis using Gel Electrophoresis: 1. DNA is extracted from cells 2. DNA is cut into pieces using restriction enzymes 3. Digested DNA is put into a gel electrophoresis apparatus Video

Fig. 20 -9 a TECHNIQUE Mixture of DNA molecules of different sizes Power source – Anode Cathode + Gel 1 4. Electricity is applied. DNA travels to + pole • Smaller fragments travel faster than larger ones Longer Power source – + molecules 2 Shorter molecules

5. Result is a banded pattern as DNA is sorted by charge & size

Another application of Biotechnology: Forensic Profiling/DNA Fingerprinting using Gel Electrophoresis • Profiling: creating a unique DNA fingerprint/profile from pieces of DNA • GENETIC MARKERS: Single base differences and areas of repeating bases; the regions of DNA that we use when comparing DNA from 2 different people

How are the DNA fragments different? ? • Humans are 99. 9% genetically identical! But…there areas of DNA that differ from person to person (Genetic Markers) – Genetic markers can be single base differences OR repeating sequences of DNA between active genes (i. e. CCGCCG) • Number of repeats for each locus varies from person to person = polymorphic

• Restriction enzymes can cut DNA sequences that flank the repeat regions – When these regions are removed from the DNA, they differ in length from one person to the other • Restriction fragments = pieces of DNA after cutting with restriction enzymes = GENETIC MARKERS

DNA GTA GTA Cut with Restriction Enzyme DNA GTA GTA DNA Cut with Restriction Enzyme GTA GTA GTA DNA Homologous Chromosomes

DNA Profiling Review W-up 1. 2. 3. 4. 5. 6. 7. 8. What percent of the DNA is identical from one human to the next? What types of differences are found in human DNA? How can we isolate/remove the variable regions from DNA? Using the sequence ATGC, create a repeating DNA segment. Pair up with a neighbor and write down the number of repeats for both of your segments (i. e. 5, 2) Find a neighboring pair and write down their numbers. Pretend that these numbers represent homologous chromosomes from two parents…what are the possible combinations of their offspring? Create a DNA profile for both parents and one child by drawing a “gel” and writing in bands to represent the restriction fragments. Label the wells (mom, dad, child) and the (+) end of the gel.

Did OJ do it? Read the short article regarding the OJ case. Answer the questions in complete sentences O. J. Simpson was a Hall of Fame football player who became a running back for the Buffalo Bills after completing a storied college career at U. S. C. Other than his heroics on the field, Simpson gained fame by starring in many major motion pictures and in television commercials. In June, 1994, Simpson was accused of murdering his exwife, Nicole Brown Simpson, and her companion, Ron Goldman. At the trial which took place a year after the deaths, DNA fingerprinting evidence was presented for the first time in a major case. The evidence was overwhelming and irrefutable, yet the jury incomprehensibly came back with an innocent verdict. It was apparent that the prosecutorial attorneys made some errors in their presentation of the DNA evidence. However, subsequent cases have been very successfully prosecuted in light of what was learned through the Simpson trial.

(a) This photo shows Earl Washington just before his release in 2001, after 17 years in prison. In 1984 he was convicted and sentenced to life in prison for the 1982 rape and murder of Rebecca Williams. Source of sample marker 1 marker 2 marker 3 Semen on victim 17, 19 13, 16 12, 12 Earl Washington 16, 18 14, 15 11, 12 Kenneth Tinsley 17, 19 13, 16 12, 12 (b) These and other genetic marker data by forensic scientists (as part of The Innocence Project) exonerated Washington and led Tinsley to plead guilty to the murder.

Scientists can artificially replicate DNA • PCR = Polymerase Chain Reaction – A method for amplifying small amounts of specific segments of DNA • Able to make lots of copies of a very specific locus in the genome • i. e. GFP gene in jellyfish – The area of interest is identified and isolated without the use of restriction enzymes An animated version of PCR

What are the ingredients for DNA replication using PCR? 1. Original DNA 2. Heat (provided by a machine called a thermocycler) – Denatures (splits) original, double stranded DNA; cools for primers; warms for polymerase 3. Primers: Single stranded DNA that is complementary to regions that flank the DNA of interest – Allows for copying the DNA in that region only 4. DNA Polymerase: specifically heat resistant taq polymerase – base pairing to replicate original sequence 5. All 4 nucleotides (A, G, C, T) – Remember, you’re copying DNA…so you need the pieces to manufacture LOTS of new strands

STEPS TO PCR: • 1. Heat to Denature (94°C) • 2. Cool to anneal primers (54°C) • 3. Elongation (72°C) – Adding new nucleotides using polymerase • 4. REPEAT An animated version of PCR

Genetic Recombination • Recombinant DNA: DNA from two different sources fused together. • – Uses: gene cloning, transgenic organisms, pharmaceuticals, gene therapy Glowing Marmoset article (a) Tobacco plant expressing a firefly gene (b) Pig expressing a jellyfish gene

Creating Recombinant DNA Requirements: 1. Gene of interest (Insulin, human growth hormone, GFP, etc. ) 2. Cloning Vector = object that will deliver the gene of interest into a living cell – Bacterial plasmid: small, circular DNA found outside bacterial chromosome; inserts gene into prokaryotes (bacteria) – Virus: tissue and species specific; can insert genes into plant, animal, or bacterial cells 3. Restriction enzymes (“Scissors”) – Used to remove gene of interest from original genome – Used to “open” vector so that gene of interest can be inserted. 4. DNA ligase (“Glue”) – attaches sugar phosphate backbones together to secure gene of interest into vector

Use of Restriction Enzymes to Create “Sticky Ends”

Fig. 20 -UN 4 5 3 TCCATGAATTCTAAAGCGCTTATGAATTCACGGC AGGTACTTAAGATTTCGCGAATACTTAAGTGCCG Aardvark DNA WHICH RESTRICTION ENZYME SHOULD WE USE? ? Eco. RI GAATT C T TA A C G Plasmid 3 5

Fig. 20 -UN 7

Fig. 20 -2 a Transformation: inserting recombinant DNA into a living cell ***Gives the cell the ability to make new proteins Bacterium 1 Gene inserted into Cell containing gene of interest plasmid Bacterial chromosome Plasmid Recombinant DNA Gene of interest 2 2 Plasmid put into bacterial cell Recombinant bacterium DNA of chromosome

Fig. 20 -2 b Recombinant bacterium 3 cell grown in culture to form clones containing the gene of interest Protein expressed by gene of interest Gene of Interest Copies of gene Protein harvested 4 Basic research and Basic research on gene Gene for pest resistance various applications Gene alters bacteria for cleaning up waste Protein dissolves blood clots Basic research on protein Human growth hormone treats stunted growth

• • Ampicillin (Amp) Resistance Gene Not all bacterial cells take up the plasmid (become transformed)… Some don’t encounter a plasmid Others reject the plasmid because it increases metabolic needs and decreases reproduction The plasmid must be beneficial to a cell while also allowing scientists to isolate those with a plasmid and those without… So, how do scientists isolate bacteria with a plasmid & encourage bacteria to keep the plasmid? Answer: Add a gene for antibiotic resistance to plasmid Grow the bacteria on antibiotic agar • Those that didn’t absorb the plasmid will die • Those that did take the plasmid have to keep it to survive

Recombination Warm-up 2/29 Plasmid Bacteria 1. Recombination requires ____ with circular ____ Gene Interest and eukaryotic ______ of ____. Plasmid 2. Remove ____ from bacterium Plasmid Gene 3. Cut ____ and remove ____ of interest using Restriction Enzyme same _________ Restriction Enzyme 4. Cutting with ______ creates ____ Sticky ends Plasmid Gene 5. Mix cut _____ and _____ ligase plasmid 6. Use ____ to glue gene into ______ Plasmid 7. Mix recombinant ______ with new bacteria growing 8. Clone gene by ____ bacteria with plasmid on nutrient agar 9. Isolate transformed bacteria using antibiotics (EXPLAIN WHY ANTIBIOTIC RESISTANCE IS IMPORTANT IN IDENTIFYING TRANSFORMED BACTERIA)

Why use antibiotic resistance? Resistance gives bacteria a survival edge in antibiotic rich environments Bacteria not exposed to plasmid = no protein production Bacteria get rid of Bacteria w/ plasmid = no plasmid = make protein desired protein

Two Applications of Recombination…

Green Fluorescent Protein

Img Src: http: //icbxs. ethz. ch/members/leu/jellyfish. gif , http: //www. plantsci. cam. ac. uk/Haseloff/SITEGRAPHICS/Jellyfish. jpeg Img Src: http: //www. biolum. org/

This sleeping baby monkey expresses GFP with the gene for the mutant Huntington protein. These animals are being used by researchers to study Huntington’s disease. Credit: Anthony Chan, Emory University

And more neato pictures brought to you by GFP: Img Src: http: //www. bio. umass. edu/microscopy/images/gfp. jpg genetik. fu-berlin. de/ institut/en_GFP_fly 3. jpg Img Src: http: //www. mshri. on. ca/nagy/graphics/GFP%2 0 mice. jpg Img Src: http: //www. computerra. ru/pubimages/73944. jpg Img Src: http: //www. antville. org/img/pop/gfp. jpg

Overall Goal of Lab Experiment n Use genetic engineering techniques to insert the GFP gene into E. coli GFP (Protein we want to produce) Amp Resistance Plasmid containing gene of interest

Transformation Lab 1. What does it mean when a bacterial cell is competent? 2. How will we make the E. coli competent? 3. What are three important genes on our recombinant plasmids? 4. How many microcentrifuge tubes will you have? What goes in each tube? 5. How many agar plates will you have? What will be in the agar?

Gene for antibiotic resistance

Pre-lab 1. Identify the materials on your desk: pipette, microcentrifuge tube, inoculating loop, agar plate Step through the procedure as a class 2. - Practice using 1 m. L pipette by obtaining. 25 m. L of water from the beaker and transferring it to the microcentrifuge tube = 0. 25 ml Pipette

Gene Therapy The use of a vector (usually a virus) to insert a working gene into a cell with a defective version of that gene 1. engineer virus to contain healthy gene 2. Infect patient’s bone marrow/stem cells in lab 3. Inject recombinant stem cells into patient’s bone marrow. – Still in its trial stages, but holds promise for treating various genetic disorders – Many setbacks including patient deaths due to severe immune response to viral vectors

Even more biotechnology… Cloning!! • Clone: exact copy of the original • How do we clone genes? – Recombinant DNA and transformation – PCR

How do we clone cells & tissues? • Therapeutic cloning of stem cells – Stem cells (embryonic, adult, or i. PS) are coaxed into various cell types using combinations of “ingredients” – These cells can then be grown together to form tissues – Layering tissues in the correct pattern will form cloned organs

Some current methods being tested for engineering organs… • Bio rubber scaffolding • “washing” cadaver organs for scaffolding • Ink jet organs

How do we clone an organism (aka reproductive cloning)? • Plants: – Specialized cells can dedifferentiate & give rise to all the cell types of a mature plant = Clone • Because of this, plant cells are totipotent!

Reproductive cloning of animals Mature animals do not have totipotent cells = Specialized cells cannot develop into new organisms • Cloning is achieved through nuclear transplantation replace the nucleus of an unfertilized egg with a nucleus from a specialized cell = CLONE

Dolly: first successfully cloned mammal via nuclear transplantation Cloning the Woolly Mammoth

Review Below

Biotechnology HW Packet 1. DNA Fingerprinting Webquest 2. Restriction Enzyme Practice 3. All Biotechnology Notes (pictures, handwritten notes, Restriction Enzymes and Recombination notes, Cloning/Stem cells notes/pictures) 4. Biotechnology Review Worksheet

STOP 09 -10

Some Vocabulary to Help Understand the Science of Cloning Specialized vs. Unspecialized Cells • All cells have the same DNA • All multicellular organisms begin as a group of unspecialized cells = stem cells – No particular function • Differences in cell types arise during development (embryo) • Different cell types result from different gene expression as an organism develops

Gel Electrophoresis is often followed by a technique called Southern Blotting Southern blotting attaches radioactive probes to the DNA so that it can be seen using x-ray technology. Why? ? ? 2 Reasons: 1. DNA digestion with Restriction enzymes produces LOTS of fragments - A probe will only attach to complementary fragments Scientists select probes that complement fragments of interest (easier to find the proverbial “needle in the haystack”) 2. DNA is colorless - X-ray allows visual image

Gel Electrophoresis and Southern Blotting to find gene of interest Add probes (stick to 1 -2 specific places) Transfer of DNA to a nylon sheet Voila: DNA F. P.

THE ENTIRE TECHNIQUE: GEL ELECTROPHORESIS & SOUTHERN BLOTTING DNA + restriction enzyme Restriction fragments I II III Heavy weight Nitrocellulose membrane (blot) Gel Sponge I Normal II Sickle-cell III Heterozygote -globin allele 2 Gel electrophoresis 1 Preparation of restriction fragments Radioactively labeled probe for -globin gene I II III 3 DNA transfer (blotting) Southern Blotting animation Probe base-pairs with fragments Fragment from sickle-cell -globin allele Nitrocellulose blot Paper towels Alkaline solution Fragment from normal -globin allele 4 Hybridization with radioactive probe I II III Film over blot 5 Probe detection

Cloning Warm-up On a piece of paper 1. What determines what you are? 2. In your own words, define clone. 3. Describe what you know about the science of cloning. 4. If you could clone any living organism, would you? If not, explain. If so, what would you clone and why? 5. What are the ethical considerations surrounding cloning?

Warm Up: Intro to DNA Fingerprinting Read about the first case in the world that used DNA evidence to convict and sentence a man to death! Answer the 3 questions on the ½ sheet using complete sentences… 1. Who is the likely suspect that assaulted the woman in this case? 2. What are the odds that someone else did it? 3. What do you think the bands represent?

Steps for using DNA as forensic evidence 1. Collect the DNA: • at the crime scene • from the suspect 2. Analyze the DNA to create DNA fingerprints (aka DNA profiles) 3. Compare the profiles to each other - CODIS

How do we analyze the DNA after it is cut? Answer: Gel Electrophoresis! A method of separating digested DNA based on its charge and fragment sizes • DNA is negatively charged • Restriction enzymes can cut DNA in very specific regions which creates fragments of DNA

Recap: Using bacterial plasmids allows us to: 1. Mass produce useful proteins – – – Insulin HGH (Human Growth Hormone) TPA (Tissue Plasminogen Activator) Desired Protein TPA HGH 2. Study/use gene itself – – – Genetically modify plants / bacteria Clone/make many gene copies Study cloned genes GM pest GM oil eating Resistant plants bacteria

Gene Therapy Technique Slows Brain Disease ALD Featured In Movie 'Lorenzo's Oil' • Cartier and her colleagues took blood stem cells from two 7 -year-old boys with ALD, infected the cells with a virus carrying a correct copy of the defective gene, then re-injected the stem cells. • The boys' symptoms stabilized within 14 months and have not worsened since. Remember the gene determines the amino acid • • sequence and the amino acid sequence determines the shape of the protein and the shape of the protein determines its function! http: //www. sciencedaily. com/releases/200 http: //www. newscientist. com/article/dn 18139 -boys-with-ald-bring-gene-therapy-in-from-cold. html 9/11/091105143706. htm

Therapeutic Cloning: Creating cells for medical use, not to develop an entire organism (a. k. a. Stem Cells) Most common sources of stem cells for cloning: - embryonic cells - adult cells

New Advances in Stem Cells • i. PS = induced Pluripotent Stem Cells (Pluripotent = ability to become any cells in the body) – Use viruses to insert developmental genes into existing skin cells • Genes “transform” skin cells into pluripotent cells • Importance: – Utilize “own” cells for research – Bypass embryonic stem cell controversy

Your 9 year old daughter has been battling leukemia for many years and is not responding to treatment. The doctors suggest a new therapy where they would infect your daughter with a deactivated HIV strain that might cure her cancer. What do you do? a) Find another doctor, these medical professionals are out of their mind. b) Try the new treatment and hope that the HIV strain cures the cancer and does not mutate into a disease causing virus. c) Do nothing, she has gone through enough treatments already. Fire with fire clip