Скачать презентацию i gene region Inhibitor gene Regulatory region p Скачать презентацию i gene region Inhibitor gene Regulatory region p

f7957489459215237f74768ad10614a9.ppt

  • Количество слайдов: 122

i gene region Inhibitor gene Regulatory region p O Gene 1 RNA polymerase repressor i gene region Inhibitor gene Regulatory region p O Gene 1 RNA polymerase repressor Structural genes region Gene 2 Gene 3

silencer enhancer promoter gene coding region silencer enhancer silencer enhancer promoter gene coding region silencer enhancer

protein A trans-acting protein trans-acting factor trans-regulation cis-regulation protein B cis-acting protein protein A trans-acting protein trans-acting factor trans-regulation cis-regulation protein B cis-acting protein

i gene region regulatory region Inhibitor gene C p. O base pair: 1000 bp i gene region regulatory region Inhibitor gene C p. O base pair: 1000 bp 100 bp lactose glucose galactose structural genes region Gene Z 3520 bp Gene Y Gene A 760 bp 810 bp

Catabolite gene activation protein site RNA polymerase binding region or promoter region 5’ TATAAT Catabolite gene activation protein site RNA polymerase binding region or promoter region 5’ TATAAT 3’ Pribnow box Operon region 20 bp

p z y a p galactose m. RNA p z y a p galactose m. RNA

5’ 3’ RNA polymerase 1 at glucose presents at glucose absents 5’ 3’ RNA polymerase 1 at glucose presents at glucose absents

RNA polymerase 5’ 3’ inhibitor gene 0 galactose RNA polymerase 5’ 3’ inhibitor gene 0 galactose

RNA polymerase 5’ 3’ inhibitor gene 0 RNA polymerase 5’ 3’ inhibitor gene 0

5’ 5’ 5’ 5’

5’…GCCGCCAGTTCGGCTGGCGGCATTTT… 3’ 5’…GCCGCCAGUUCGGCUGGCGGCAUUUU… 3’ U G U 5’ G A C C G C 5’…GCCGCCAGTTCGGCTGGCGGCATTTT… 3’ 5’…GCCGCCAGUUCGGCUGGCGGCAUUUU… 3’ U G U 5’ G A C C G C U G G C A U U-OH 3’

p Attenuater Anthranilic acid Chorismic acid Indolglycerol phosphate Tryptophan p Attenuater Anthranilic acid Chorismic acid Indolglycerol phosphate Tryptophan

at a lot of tryptophans present p Trp Inactive repressor Repressor at a few at a lot of tryptophans present p Trp Inactive repressor Repressor at a few tryptophans present or tryptophans absent p RNA polymerase whole m. RNA Inactive fragmentary m. RNA repressor

M K A I M K A F LKG 1 2 3 4 Try M K A I M K A F LKG 1 2 3 4 Try code I F LK GW W R 1 Try code 3 2 4

Antisens RNA Protein Antisens RNA Protein

RNA ds. DNA solenoid transcription bubble chromatid supersolenoid chromosome nucleosomes RNA ds. DNA solenoid transcription bubble chromatid supersolenoid chromosome nucleosomes

RNA polymerase RNA polymerase

RNA polⅠ r. RNA polⅠ RNA polⅠ r. RNA polⅠ

TF Ⅲ B TF Ⅲ C RNA pol Ⅲ t. RNA TF Ⅲ B TF Ⅲ C RNA pol Ⅲ t. RNA

TF Ⅲ B TF Ⅲ C RNA pol Ⅲ t. RNA TF Ⅲ B TF Ⅲ C RNA pol Ⅲ t. RNA

TF Ⅲ B TF Ⅲ A RNA pol Ⅲ TF Ⅲ C 5 s TF Ⅲ B TF Ⅲ A RNA pol Ⅲ TF Ⅲ C 5 s r. RNA

silencer enhancer promoter gene coding region silencer enhancer silencer enhancer promoter gene coding region silencer enhancer

enhancer core sequence enhancer core sequence

Gene regulatory proteins transcription initiation complex RNA pol II 5’ Enhancer-2 3’ Enhencer-1 gene Gene regulatory proteins transcription initiation complex RNA pol II 5’ Enhancer-2 3’ Enhencer-1 gene TATA box Enhancer-3 +10 kb to +50 kb

regulatory protein promoter transcription initiation complex regulatory protein promoter transcription initiation complex

enhancer promoter enhancer promoter

Gene regulatory proteins transcription initiation complex RNA pol II 5’ 3’ enhancer gene various Gene regulatory proteins transcription initiation complex RNA pol II 5’ 3’ enhancer gene various control element TATA box silencer +10 kb to +50 kb

TF Molecular weitht, k. D Function TF II A TF II B 12, 19, TF Molecular weitht, k. D Function TF II A TF II B 12, 19, 35 33 stabilize TF II D TBP/38, TAP/15 -250 TF II E TF II F TF II H 30, 74 35 -89 TF II I 120 accelerate that RNA pol II binding with DNA. recognize TATA box ATPase helicase phosphorylation of carboxyl terminal domain of RNA pol II large subunit accelerate that TF II D binding TATA

C C C Zn H C H H H COOH C C C Zn H C H H H COOH

O H N Leucine residue C C CH COOH 1 1 8 8 15 O H N Leucine residue C C CH COOH 1 1 8 8 15 15 22 22 29 29 36 36 COOH

3 2 2 1 3 2 1 1 3 2 2 3 3 2 3 2 2 1 3 2 1 1 3 2 2 3 3 2 3 1

2 3 1 2 3 1

Poly A site initiation site upstream silencer AATAAA, 30 bp ATG TAA downstream enhancer Poly A site initiation site upstream silencer AATAAA, 30 bp ATG TAA downstream enhancer 5’ 1 1 2 2 n-1 terminator upstream promoter enhancer GC box CAAT box n TATA box coding 3’ strand template strand downstream silencer

EBP TF II F TF II A TATA TF II B TF II E EBP TF II F TF II A TATA TF II B TF II E

TATA TBP TAF TF II A TF II E TF II B PIC EBP TATA TBP TAF TF II A TF II E TF II B PIC EBP TF II F TF II A TATA TF II B TF II E

activity of gene structure function chromatin amino acid activity of gene structure function chromatin amino acid