High-throughput genotyping Finnish Genome Center 18 March 2018

High-throughput genotyping Finnish Genome Center 18 March 2018 1

What is genotyping? • the analysis of DNA-sequence variation • genotype = the genetic constitution of an individual Finnish Genome Center

Alleles • alternative form of a gene or DNA sequence at a specific chromosomal location (locus) • at each locus an individual possesses two alleles, one inherited from the father one from the mother → genotype: a sum of these two alleles Finnish Genome Center

Genetic differences: • may cause or predispose to diseases • determines e. g. individual drug response • used as markers to identify predisposing genes for diseases → high-throughput genotyping technologies needed Finnish Genome Center

Microsatellite markers Di-, tri-, tetranucleotide repeats GAACGTACTCACACACATTTGAC TTCGATGATAGATAGATACGT Finnish Genome Center

. . . Microsatellite markers • also called: • STR= Single Tandem Repeat • SSR= Simple Sequence Repeat • SSLP= Simple Sequence Length Polymorphism • • the number of repeats varies (→ 30) highly polymorphic distributed evenly throughout the genome easy to detect by PCR Finnish Genome Center

SNP markers • single nucleotide variation GTGGACGTGCTT[G/C]TCGATTTACCTAG Finnish Genome Center

. . . SNP markers • The most simple and common type of polymorphism • Highly abundant; every 1000 bp along human genome • Most SNPs do not affect on cell function • some SNPs could predispose people to disease • influence the individual’s response to a drug • Widely used as genetic markers Finnish Genome Center

SNP genotyping methods • over 100 different approaches • Ideal SNP genotyping platform: • • • high-throughput capacity simple assay design robust affordable price automated genotype calling accurate and reliable results Finnish Genome Center

. . . SNP genotyping methods • PCR • discrimination between alleles: • • allele-specific hybridization allele-specific primer extension allele-specific oligonucleotide ligation allele-specific enzymatic cleavage • detection of the allelic discrimination: • light emitted by the products • mass • change in the electrical property Finnish Genome Center

The Finnish Genome Center • Independent department of University of Helsinki • Since 1998 • National core facility for the genetic research of multifactorial diseases • Provides collaboration and genotyping service to scientist and research groups in Finland, also abroad Finnish Genome Center

The Finnish Genome Center; Goals • • • help designing genetic studies perform high-throughput genotyping perform data analysis training of scientists adopt and develop new strategies & technologies Finnish Genome Center

Research strategies • Genome wide scans with microsatellite markers • ~400 dinucleotidemarkers, ~10 c. M spacing • Fine mapping • Project specific (microsatellite) markers • SNP genotyping • Primer extension –methods (SNu. Pe and Mass. Array; MALDI-TOF), restriction enzyme –methods, project specific markers Finnish Genome Center

Genome Scan • genotyping the whole genome with 400 microsatellite markers at 10 c. M interval • look for chromosomal regions with excess allele sharing 0 10 20 30 40 50 60 70 80 90 100 110 120 130 microsatellite markers at 10 c. M distance Finnish Genome Center

Fine mapping • • candidate regions identified by a genome scan candidate genes microsatellite or SNP markers verification of linkage results Finnish Genome Center

Setting up PCR-reactions Finnish Genome Center

Electrophoresis run Finnish Genome Center

Genotypes Finnish Genome Center

What the data looks like Marker Well ID Sample. ID Allele 1 Allele 2 Size 1 Size 2 D 7 S 513 H 01 OA. 11616 26 28 190. 93 195. 02 D 7 S 517 C 07 DYS. 5020 26 26 262. 19 D 7 S 640 B 02 DYS. 3819 26 29 133. 41 139. 41 D 7 S 640 G 12 OA. 1528 26 29 133. 59 139. 46 D 7 S 669 E 05 OA. 11615 26 29 190. 37 196. 61 D 8 S 258 B 06 DYS. 5001 26 27 159. 38 161. 38 D 8 S 260 C 02 DYS. 3931 26 26 215. 57 D 8 S 264 H 01 OA. 11616 26 26 158. 86 Finnish Genome Center

SNP genotyping at FGC • PCR-RFLP (restriction fragment length polymorphism) • SNu. Pe (Single nucleotide primer extension) • Mass. ARRAY; MALDI-TOF (Matrix Assisted Laser Desorption/Ionization Time-of-flight mass spectrometry) Finnish Genome Center

PCR-RFLP • Reactions designed to produce products of different sizes after enzymatic cleavage Undigested PCR product C analyte T analyte size in bp 243 228 94 Finnish Genome Center

SNu. Pe • primer extension reactions designed to produce differentially labelled products • analysis by capillary electrophoresis (Mega. BACE) labelled nucleotide Extendable primer GGACCTGGAGCCCCCACCC C (blue) C analyte GGACCTGGAGCCCCCACCT T (red) T analyte Finnish Genome Center

Mass. ARRAY System (MALDI-TOF) • Primer extension reactions designed to generate different sized products • Analysis by mass spectrometry C/T G/A d. GTP d. TTP d. ATP dd. CTP G/A Mass in Daltons Extendable primer GGACCTGGAGCCCCCACC 5430. 5 GGACCTGGAGCCCCCACCC 5703. 7 C analyte GGACCTGGAGCCCCCACCTC 5976, 9. 9 T analyte Finnish Genome Center

Mass spectrometry multiplexing Finnish Genome Center

Primer extension mass spectrometry Advantages: • • accurate automated assay design fast automated data collection multiplexing capacity Disadvantages: • expensive instruments, consumables • extensive post-PCR processing Finnish Genome Center

SNP genotyping workflow at FGC Finnish Genome Center