Green Genes DNA Project Workshop Presentation Group Leaders

Green Genes: DNA Project Workshop Presentation Group Leaders & Teachers may also opt to use this presentation with their group and it will be made available on CD and for downloading off the Web. Adapted with permission from Dr. Molly Fitzgerald Hayes & Dr. Frieda Reichsman from their “My. DNA K 12 Teachers Workshop” in 2002.

From“My. DNA K 12 Teacher Workshop” to “Green Genes: a DNA project” UMass My. DNA Class Frieda People in the Five College Learning in Retirement Program… Most Cells …Isolate Their Own DNA! Molly

Green Genes: a DNA Project Have fun With DNA! Learn About Your DNA, Genes and the Human Genome Read and understand DNA language Discover YOUR “Book of Life”- the genome Master Plan Understand the power and potential of DNA, genes and genomes In the Green Genes: DNA project Workshop Youth Development Professional & Volunteers Will: Find out about awesome and revealing information discovered about the human genome. Participate in exciting, safe and affordable, hands-on learning activities appropriate for Afterschool and the classroom. Learn about user-friendly on-line DNA molecules

. What is the Human Genome? What is the Human Genome Project? The HUMAN GENOME: • DNA encoding all human genetic information • “Master Plan” for the human organism • The Body’s Master Plan The HUMAN GENOME PROJECT: • An international effort to create a complete record of the human “Master Plan”: 1) Sequence the order of the letters (list of instructions) 2) Map the “landmarks” (physical locations, blueprint) National Human Genome Research Institute www. nhgri. nih. gov SV 40 VIRUS

What are the Goals of the Human Genome Project? • Determine every single letter (base) in our genome DNA (in order). • Read the DNA letters to form the words in our genome instructions (genes). • Locate the instructions (genes, 5%) in the books (chromosomes). • Store the information in databases. • Develop tools for data analysis. • Address the ethical, legal, and social issues arising from the HGP (3%-5% of the budget).

The Genome Instructions The Human Genome: instruction book for making a human • YOUR genome is like a vast set of books comprising a specific Master Plan for creating YOU. For example, • Blue eyes • Brown hair • The HUMAN Genome is the generalized Master Plan. For example, • Eyes (not the specific color or shape) • Hair (not the specific color or texture) • The Genome/Master Plan is written in a molecular language, using DNA instead of paper and ink. • The foremost goal of the Human Genome Project was to “read” and record every letter (base) of the Human Master Plan.

Medical Benefits from Genome Research • Better disease diagnosis • Early detection of genetic diseases • Gene therapy treatments • Detection and cures for cancer • Targeted drug designs • Control systems for drug delivery • Personalized treatments and cures • Customized drugs

Other Applications of the Human Genome Project DNA Science Has a Huge Impact on Many Diverse Fields Anthropology: Where Did Modern Human Ancestors Come From? • • Archeology: Cloning mummy DNA! • Bio-History: Using DNA to Understand the Past! • The Tell-Tale Heart: DNA Identifies Son of King Louis XVI and Queen Marie Antoinette • Bio-Terrorism and Anthrax • Law, Justice, and The Innocence Project • DNA Privacy and Genetic Discrimination • Lawsuit: Can They Make You Share Genetic Secrets? • Pharmacogenetics: Medicine Prescribed by Your DNA! • Genetically Modified Crops • Genome Music • Gene Therapy • Biomedical Ethics

Our DNA Story Variations on the Human Theme! People look very different from each other, yet, we all have features in common.

Traits are Variations on the Human Theme Human traits are human characteristics that can vary. Simple traits: • Eyes: Blue, brown, green, etc. • Earlobes: attached, free Complex traits: • Susceptibility to a disease Your traits are inherited from your biological parents via genes!

Genes are Physical Elements Responsible for Inherited Traits Genes are made of DNA: • Genes determine your traits and influence your development • Genes are the means of passing on your traits to your biological children As a child develops from a fertilized egg: • Genes direct development • When genes act, they are said to be “expressed” • Traits are the result of gene expression.

What Genes Can and Can’t Do! Genes Can…. • control traits (hair color, eye color, skin color, etc. ) • cause disease (sickle cell, hemophilia, cancer, etc. ) • influence personality, talents, weaknesses, hobbies, likes, dislikes • increase risk for heart disease, stroke, alcoholism, Alzheimer’s, etc. Genes Can’t… • make your decisions for you • force you to be a criminal or do things against your will • excuse poor life choices or lack of personal responsibility Genes ALWAYS… • work together with your environment Example: genes for growth are influenced by nutrition

The Human Genome is Your Body’s Master Plan! Your Genome Master Plan has: • A list of parts needed to make a unique person, YOU! • Genes with specific instructions for each part needed • Genes written in a coded DNA language DNA • 46 “books” called chromosomes! Chromosomes: 46 Books of Life!

The Human Genome: A Molecular Instruction Book Master Plan Genome 1 Books/Volumes Chromosomes 23 Instructions Genes 30, 000 Words Codons 1 billion Letters Bases (DNA) 3 billion

Introduction to DNA “Language” English Language Books • Written on paper • 26 characters • Words of varying length • Punctuation marks DNA Language “Books” • Written on DNA • 4 characters • Three letter words • Special words The four characters of DNA are A, C, G, and T. They stand for four chemical constituents of DNA: • Adenine, Cytosine, Guanine, Thymine. An example of one “strand” of DNA (one DNA molecule): AGCCGTTTTATACGCGTAGTCGTAGCTCGAGCAAATTA Adapted from “Genome” by Matt Ridley, Perennial Books, NY

DNA “Language” is Written Between the DNA Strands DNA Double Helix DNA letters are strung together in chains, and are attached along the DNA backbone. Two DNA strands wrap around each other in a spiral shape called a double helix. Each chromosome contains one pair of extremely long DNA strands, twisted in a double helix. Two strands = Double helix

DNA Base-Pairing Carries a Message The MOST INGENIOUS feature of DNA: • A likes to pair with T DNA Strand #1 • C likes to pair with G The DNA strands in a helix are complementary. DNA Strand #2 The DNA language contained in a gene is always read only from one DNA strand at a time. G - C C - G G - C A - T

Introduction to DNA “Language” • The four bases in DNA are “letters” in the genetic code: Adenine, Thymine, Guanine, Cytosine • Ignoring the 3 D structure of DNA, the code can be written linearly • The sequence (exact order) of the “letters” holds their meaning Follow the Arrow DNA STRAND #1 DNA STRAND #2 GTGGTCTTCAGGAC CACCAGAAGTCCTG #1 #2

Introduction to DNA “Language” • The four bases in DNA are “letters” in the genetic code: Adenine, Thymine, Guanine, Cytosine • Ignoring the 3 D structure of DNA, the code can be written linearly • The sequence (exact order) of the “letters” holds their meaning DNA STRAND #1 DNA STRAND #2 GTGGTCTTCAGGAC CACCAGAAGTCCTG #1 #2

Introduction to DNA “Language” • The four bases in DNA are “letters” in the genetic code: Adenine, Thymine, Guanine, Cytosine • Ignoring the 3 D structure of DNA, the code can be written linearly • The sequence (exact order) of the “letters” holds their meaning DNA STRAND #1 DNA STRAND #2 Etc… GTGGTCTTCAGGAC CACCAGAAGTCCTG #1 #2

Genes Store and Send Your DNA Master Plan Your Genes are Written in Four DNA Letters A, Nucleus T, G, C The nucleus READS the genes and sends INSTRUCTIONS that tell the CELL what to do. Cell makes protein parts that assemble into the molecular machines that do the work in the cell!

Protein Chains Fold to Make Functional 3 D Proteins DNA: GTC TTC AGG CCA AAT TTT GTC GCG CCA GGA ATT Protein: Amino acid chain folds to make a 3 D protein Proteins are Very Versatile: • Enzymes: machines that do the work of the cell • Structural Proteins: determine shape and layout of the cell A mis-folded protein will not do its job! Human proteins have 20 different amino acid building blocks

Different Protein Chains Fold to Make Proteins with Different 3 D Shapes and Biological Functions Protein #1 Protein #2 Protein #3 Protein #2 Protein #1 Human proteins have 20 different amino acid building blocks Protein #3

How Big is the Human Genome? Each human genome has 3. 2 billion DNA letters = 3, 200, 000 = 3. 2 x 109 How BIG is 3. 2 billion? • 200 New York City telephone books • 800 Bibles • 3 Gigabyte computer hard drive • a person typing 60 words/minute for 8 hours/day would take more than 50 years to type all the letters in the human genome DNA • end-to-end the DNA in one human cell will extend almost 6 feet long

There is More to Our Genome Than Just Genetic Information! What Does It Say? Master Plan Genome 1 Books/Volumes Chromosomes 23 Instructions Genes 30, 000 Words Codons 1 billion Letters Bases (DNA) 3 billion Surprise! 98% of Human Genome DNA is Gibberish!! Gibberish DNA sequences are not genes. They can be read, but are not yet understood by us!

Compare Any Two Human Genomes: They are 99. 9% Identical! Look around the room and see how different we all look. Then compare two human genomes: • The DNA letters are almost the identical order (sequence) between any two human genomes! • A very small number (0. 1%) of the DNA letters differ between any two human genomes. • What about identical twins? Genome Facts: NOVA Online

Activity #1: Alphabet Traits

Alphabet Traits: DNA Fingerprinting 1. Enter your traits in the grid above, selecting them from the list below. (See Example on next page) Sex - male or female Eye color – blue, brown, hazel, or green Ear Lobes – free or attached Hairline – widows peak or no widows peak Little finger – bent or straight Chin – dimples or no dimples Tongue – roller or nonroller Skin – freckles or no freckles Spelling counts !!! Please proofread ! PLEASE DO NOT SKIP SPACES BETWEEN WORDS

You should have one continuous set of traits, something like this: Alphabet traits Page two F N 2. Cut out your traits along the heavy black lines and then tape them together end to end. You should have one long strip with all your trait words in a row, no spaces between any letters. Cut off and discard any empty boxes at the end. 3. Now, cut your traits between the following letters. Cut only when the letters occur in the order shown, not the reverse order: E-M T-T O-F E-E S-P F-R B-R G-H N-R E-N O-D E-W 4. Arrange your cut traits by length on the Size Sorting Template. Compare with your classmates! Adapted from: Iowa Academy of Science, http: //ists. pls. uni. edu/biomes-geomes/biomes/PDF/sentencesplitting. DNA. pdf

YOUR DNA: Your Ultimate Genetic Bar Code Activity #1: Alphabet Traits: • the students individual physical traits are used to • make specific strings of English language letters that • are cut into patterns of shorter strips • these patterns can specifically identify individual people DNA Fingerprinting is a method where: • a person’s genetic traits, genes, are used to • make specific strings of DNA letters that • are cut into patterns of shorter strings separated by length • these banding patterns can identify a unique human being! YOUR DNA Banding Pattern Will Identify YOU! www. biology. washington. edu/fingerprint/dnaintro. html

Image of a DNA fingerprint

Compare Any Two Human Genomes: They are 99. 9% Identical! Look around the room and see how different we all look. Then compare two human genomes: • The DNA letters are almost the identical order (sequence) between any two human genomes! • A very small number (0. 1%) of the DNA letters differ between any two human genomes. Small DNA differences can identify individuals as unique. • Except for identical twins! Genome Facts: NOVA Online

Maybe You Shouldn’t Believe Your Eyes! DNA Fingerprinting Reveals The Truth! DNA Fingerprinting has exonerated people who were falsely convicted. What is the most common error leading to wrongful conviction? Mistaken Eyewitness Identification!

Awesome Power: The Innocence Project: DNA MIGHT SET YOU FREE! Started by O. J. Dream Team Lawyers • Use power of DNA Fingerprinting to “confirm” selected trial verdicts. • Have freed over 100 prisoners who were wrongfully convicted. • Even some Death Row inmates exonerated! • http: //www. innocenceproject. org/

Activity #2: Swish and Spit to Isolate Your Own DNA!

SWISH AND SPIT EXPERIMENT BEFORE YOU START We WILL DEMO NOVA Cracking the Code of Life Home Web Site: http: //www. pbs. org/wgbh/nova/genome/ NOVA Swish and Spit Activity Site: http: //www. pbs. org/wgbh/nova/teachers/activities/2809_genome. html

Make Your Own Genome DNA The Swish and Spit Human DNA Isolation Experiment HERE WE GO! • People will work in PAIRS today. • Each pair will process ONLY ONE DNA sample at a time. • Everyone will isolate her own DNA by the end of class. CHECK: Make sure you have these supplies BEFORE YOU START THE EXPERIMENT! Each PERSON Should Have: 1 plastic cup with 10 ml salt solution (0. 9%) [Marked: SALT] 1 large tube with 5 ml detergent (25%) [Marked: SOAP] CHECK that you can READ the markings on the tubes or cups.

Swish and Spit Human DNA Isolation Steps 1 and 2: Harvest Your Cells, Please! Experimental Procedure: STEP 1 and STEP 2 • Be sure to follow the instructions carefully. • If you make a mistake, No problem. • ASK for help right away! WAIT! WE WANT EVERYONE TO START AT THE SAME TIME! 1. Pour the ENTIRE contents of the PLASTIC CUP marked SALT into your mouth. SWILL the salt solution around inside your mouth for about 30 SECONDS. 2. SPIT the SALT solution back into the PLASTIC CUP marked SALT.

Swish and Spit Human DNA Isolation Steps 3 and 4: Put the Cells into the SOAP: Why? Experimental Procedure: STEP 3 and STEP 4 3. Carefully POUR the contents of the plastic cup (SALT) into the LARGE screw cap test tube marked SOAP. 4. CAP the tube with the screw cap so that it is securely closed. GENTLY TILT the SOAP tube side-to-side for 3 MINUTES. IMPORTANT: DO NOT SHAKE THE SOAP TUBE! NO BUBBLES, PLEASE!

Swish and Spit Human DNA Isolation Steps 5 and 6 Experimental Procedure: STEP 5 and STEP 6 5. OPEN the SOAP tube and hold it at a slightly TILTED angle. CAREFULLY POUR the COLD ethanol (ETOH) from ONE small screw cap tube down the INSIDE WALL of the SOAP tube. ETHANOL (ETOH) SOAP The COLD ethanol (ETOH) SHOULD FORM A LAYER on TOP of the SOAP 6. Set the ETOH/SOAP tube into a rack on the desk for 1 (ONE) MINUTE

Swish and Spit Human DNA Isolation Step 7: Spool The Stuff Of Life… Experimental Procedure: STEP 7 7. CAREFULLY place the wooden stick into the top, ETOH layer but NOT INTO THE SOAP LAYER. INTERFACE SLOWLY stir in ONE DIRECTION. DO NOT MIX the SOAP layer with the TOP layer!!!! ETHANOL (ETOH) SOAP YOU ARE TRYING TO WIND LONG DNA STRANDS AROUND THE STICK (ALTHOUGH YOU PROBABLY CAN’T SEE THE DNA YET)

Swish and Spit Human DNA Isolation Step 8: See the DNA? Experimental Procedure: STEP 8 8. Slowly stir the glass rod in the TOP layer for several minutes. Remove the glass rod from the ETOH/SOAP tube and place it into the SECOND small screw cap tube of ethanol (ETOH). You should begin to see the DNA strands winding onto the stick by now. GENTLY dislodge the clumps of DNA from the stick and CAREFULLY transfer to the SECOND (ETOH) tube. CAN YOU SEE YOUR DNA? ?

Activity #3: Build a DNA Model from Paper Parts!

Make Your Own DNA Model! • Please work in pairs. 1. Make the building blocks of DNA - NUCLEOTIDES A. Cut out the patterns for 10 bases, 20 sugars, and 20 phosphates. B. Tape a chemical base to a sugar molecule by matching up the dots. C. Tape a phosphate group the sugar by matching up the stars. 2. Make 10 nucleotides. 3. Lay out a double-stranded DNA molecule using your 10 nucleotides-- DO NOT TAPE YET!!! 4. Have your model checked before proceeding to step 5. 5. Tape your model together. 6. Tape your model to another model. 7. Twist carefully, hang it up where everyone can admire it! http: //www. mcps. k 12. md. us/departments/isa/ninvest/dogma/ballesson. htm

Workshop Resources My. DNA Public Web Site: http: //www. bio. umass. edu/biochem/mydna/ Frieda Reichsman’s Web Site: Molecules. In. Motion. com Cold Spring Harbor DNA Learning Center: http: //www. dnalc. org/ National Human Genome Research Institute: Genome Hub http: //www. genome. gov/page. cfm? page. ID=10001674 NCBI Pub. Med (Free access to 12 million MEDLINE citations at National Library of Medicine): http: //www. ncbi. nlm. nih. gov/entrez/query. fcgi My. DNA Course (Spring 2002) Website: http: //bcrc. bio. umass. edu/courses/spring 2002/biochm 193 a/syllabus. phtml Ethical, legal and social implications (ELSI) of HGP. Created by Phil Tompkins (Five College Learning in Retirement Program, Amherst, MA). http: //www. pdindex. org/lir. htm NOVA: Cracking the Code of Life: http: //www. pbs. org/wgbh/nova/genome/

References for Hands On Activities Activity#1: Alphabet Traits (Adapted from Iowa Academy of Science): http: //ists. pls. uni. edu/biomes-geomes/biomes/PDF/sentencesplitting. DNA. pdf Activity #2: Swish and Spit DNA Isolation Adapted from NOVA “Cracking the Code of Life” Home: http: //www. pbs. org/wgbh/nova/genome/ Swish and Spit Activity: http: //www. pbs. org/wgbh/nova/teachers/activities/2809_genome. html Activity #3: Build a DNA Model from Paper Parts! Adapted from: http: //www. mcps. k 12. md. us/departments/isa/ninvest/dogma/ballesson. htm