Скачать презентацию Геном человека ГЕНОМ ЧЕЛОВЕКА Геном n n Скачать презентацию Геном человека ГЕНОМ ЧЕЛОВЕКА Геном n n

218f28ad3773ba6c76a077473ef74a5d.ppt

  • Количество слайдов: 82

Геном человека ГЕНОМ ЧЕЛОВЕКА Геном человека ГЕНОМ ЧЕЛОВЕКА

Геном n n Термин «геном» был введен в 1920 г. немецким ботаником Гансом Винклером Геном n n Термин «геном» был введен в 1920 г. немецким ботаником Гансом Винклером ( «совокупность генов, заключенных в гаплоидном наборе хромосом организмов одного биологического вида» ) Полный состав ДНК клетки, т. е. совокупность всех генов и межгенных участков

Геномика – раздел генетики, занимающийся изучением геномов живых организмов. Термин «геномика» впервые употребил генетик Геномика – раздел генетики, занимающийся изучением геномов живых организмов. Термин «геномика» впервые употребил генетик Томас Родерик в 1986 г. для обозначения картирования, секвенирования и характеристики геномов. Фактически Геномика стала самостоятельным разделом биологии после 1990 г. благодаря проекту «Геном человека» . Сейчас геномика разделилась на несколько направлений.

Геномика Структурная Функциональная Сравнительная Эволюционная медицинская Геномика Структурная Функциональная Сравнительная Эволюционная медицинская

Структурная геномика Изучает: n последовательность нуклеотидов в геномах (секвенирование) n Строение генов n локализацию Структурная геномика Изучает: n последовательность нуклеотидов в геномах (секвенирование) n Строение генов n локализацию генов (картирование)

Функциональная геномика Изучает: n функции генов и других элементов генома n Взаимодействия генов и Функциональная геномика Изучает: n функции генов и других элементов генома n Взаимодействия генов и их продуктов n Регуляцию работы генов на всех уровнях от молекулярного до организменного

Реализация генетической информации: ДНК → транскрипция РНК → белок трансляция Транскриптом – полный набор Реализация генетической информации: ДНК → транскрипция РНК → белок трансляция Транскриптом – полный набор транскриптов, производимый клеткой n Протеом – полный набор белков, вырабатываемых клеткой n Метаболом – совокупность продуктов метаболизма клетки n

Сравнительная геномика Изучает: n Сходства и различия в организации геномов разных организмов с целью Сравнительная геномика Изучает: n Сходства и различия в организации геномов разных организмов с целью выяснения общих закономерностей их строения и функционирования

Эволюционная геномика Изучает: n Происхождение генетического полиморфизма n Формирование комплексов генов и хромосом n Эволюционная геномика Изучает: n Происхождение генетического полиморфизма n Формирование комплексов генов и хромосом n Роль горизонтального переноса генов n Расообразование n Эволюция наследственной патологии

Медицинская геномика n n Изучает: Генетическую природу наследственных заболеваний Сцепление заболеваний с полиморфными маркерами Медицинская геномика n n Изучает: Генетическую природу наследственных заболеваний Сцепление заболеваний с полиморфными маркерами разработка методов ДНК- диагностики наследственных и инфекционных заболеваний Разработка методов генотерапии

Интересные факты программы «Геном человека» n n n Количество генов у человека 24 000 Интересные факты программы «Геном человека» n n n Количество генов у человека 24 000 - 30 000 Фенотип известен для 3 777 (на 2012 г) Протеом включает около 120 000 белков Более 200 генов общих с бактериями Все представители Homo sapiens на 99, 9% идентичны по нуклеотидным последовательностям ДНК!!! Уровень мутаций у мужчин в 2 раза выше, чем у женщин

Уровни организации генома n n n n Нуклеотиды Кодоны Домены Гены и межгенные участки Уровни организации генома n n n n Нуклеотиды Кодоны Домены Гены и межгенные участки Сложные гены Хромосомы Гаплоидный набор хромосом + внехромосомная и внеядерная ДНК

Характеристика генома Свойства генома: n видоспецифичность n дискретность n избыточность n Наличие мобильных элементов Характеристика генома Свойства генома: n видоспецифичность n дискретность n избыточность n Наличие мобильных элементов

5‘ конец ДНК - уровень 3‘ конец n n n 3‘ конец 5‘ конец 5‘ конец ДНК - уровень 3‘ конец n n n 3‘ конец 5‘ конец Физический размер генома человека: 3 х 109 п. н. 99, 5%ДНК в хромосомах 0, 5% - ДНК митохондрий, кольцевые молекулы ДНК в ядре и цитоплазме

Физический размер генома Прокариоты - до 8*106 п. н. Эукариоты 106 - 1011 п. Физический размер генома Прокариоты - до 8*106 п. н. Эукариоты 106 - 1011 п. н. Человек 3, 3*109 кишечная палочка 4*106 Дрозофила 1, 4*108

Сравнительная характеристика геномов про- и эукариот прокариоты Размер 4 х106 н. п. (1 мм) Сравнительная характеристика геномов про- и эукариот прокариоты Размер 4 х106 н. п. (1 мм) 4 000 генов эукариоты 3 х 109 п. н. (2 м) 30 000 генов гены 90% ДНК Нет повторяющихся последовательностей гены - 30% всей ДНК 15%-50% ДНК - повторяющиеся последовательности кодирующая область гена непрерывна экзон-интронная структура кодирующие области 3% Полицистронная модель гена опероны Моноцисторонная модель гена Регуляция только на стадии транскрипции Регуляция на всех стадиях реализации генетической информации + гормональная регуляция

Генетический размер генома Морганида – единица сцепления генетических маркеров. n 1 с. М соответствует Генетический размер генома Морганида – единица сцепления генетических маркеров. n 1 с. М соответствует физическому расстоянию на генетической карте между двумя маркерами, рекомбинация между которыми происходит с частотой 1%. n Генетический размер генома 3, 3*103 с. М n

Геном Ядерная ДНК 99, 5% Гены 25 -35% Внегенная 75 -65% Кодирующие Некодирующие Последовательности Геном Ядерная ДНК 99, 5% Гены 25 -35% Внегенная 75 -65% Кодирующие Некодирующие Последовательности 10% ДНК митохондрий 0, 5% 90% Повторяющиеся (уникальные и умеренные) 60% Высоко повторяющиеся 40% Только 2, 5 – 3, 5% ДНК кодируют синтез белка!!!

Геном митохондрий Содержит 16 569 п. н Кодирует: n 2 р. РНК n 22 Геном митохондрий Содержит 16 569 п. н Кодирует: n 2 р. РНК n 22 т. РНК n 13 полипептидов (входят в состав ферментативных комплексов окислительного фосфорилирования)

Отличия от ядерного генома n n n n ДНК не связана с гистонами не Отличия от ядерного генома n n n n ДНК не связана с гистонами не содержит интронов Транскрибируются обе цепи Генетический код немного отличается от универсального Нет системы репарации ДНК (мутации происходят в 10 раз чаще!!!) Внутри одной клетки могут находиться митохондрии с разной мт. ДНК (гетероплазмия) Комбинативная изменчивость отсутствует. Нуклеотидная последовательность меняется только в результате мутаций мт. ДНК наследуется по материнской линии

Митохондриальные болезни Митохондриальные болезни

Ядерная ДНК Уникальные последовательности - single-copy DNA (в основном находятся в генах) Повторяющиеся нуклеотидные Ядерная ДНК Уникальные последовательности - single-copy DNA (в основном находятся в генах) Повторяющиеся нуклеотидные последовательности различной длины и состава, которые встречаются в геноме несколько раз n У дрожжей до 20%, n у млекопитающих до 60% n У растений 80%.

Повторы – это…. . n n n n Дупликации генов и генные семейства кластеры Повторы – это…. . n n n n Дупликации генов и генные семейства кластеры рибосомальных генов, генов т. РНК Псевдогены Интегрированные вирусы и их копии Множественные копии мобильных элементов. Повторы структурного гетерохроматина: центромерах, теломерах, коротких плечах акроцентрических хромосом Внегенные повторы в эухроматине: мини- и микросателлиты Гены т. РНК в среднем повторяются в геноме 5 тыс. раз. Гены р. РНК - сотни тысяч раз.

Функции повторов Структурная n Эволюционное происхождение генов (дупликации, неравный кроссинговер) n Более высокий уровень Функции повторов Структурная n Эволюционное происхождение генов (дупликации, неравный кроссинговер) n Более высокий уровень синтеза продукта n ? ? n

Классификация повторов По числу повторов: n Умеренно повторяющиеся - до 1000 повторов в одном Классификация повторов По числу повторов: n Умеренно повторяющиеся - до 1000 повторов в одном локусе n Высокоповторяющиеся – более 1000 повторов, иногда миллионы копий на геном По распределению в геноме: n Тандемные (расположены друг за другом) n Диспергированные

Тандемный динуклеотидный повтор cattagttgacctaaacacacacacacaccccttgccaaa Тандемный динуклеотидный повтор cattagttgacctaaacacacacacacaccccttgccaaa

Тандемные повторы По длине: n Микросателлиты 1 -6 н. п. (общая протяженность повтора несколько Тандемные повторы По длине: n Микросателлиты 1 -6 н. п. (общая протяженность повтора несколько сотен н. п. ) n Минисателлиты - 7 -100 н. п. (общая протяженность 102 -105 н. п. Состоят в основном из гуанина и цитозина Микро- и минисателлиты используются как молекулярные маркеры в определении родства, принадлежности к конкретной популяции, для исследования гибридизации. Находятся в эухроматине n Сателлиты – более 100 н. п. (общая протяженность от 100 тысяч до более чем 1 миллиона н. п. Находятся в конститутивном гетерохроматине (теломерные и центромерные области хромосом. занимают около 3— 5 % размеров каждой хромосомы

Сегментные дупликации n n Длинные низкокопийные повторы до 100 000 п. н. Образуют крупные Сегментные дупликации n n Длинные низкокопийные повторы до 100 000 п. н. Образуют крупные блоки, часто в прицентромерных и субтеломерных районах хромосом (7, 15, 17, 22, Х) Имеют высокую степень идентичности Возможен неравный кроссинговер, что приводит к микроделециям и микродупликациям

CNV – Copy Number Variation Длинные повторы от 100 000 до 2, 2 млн. CNV – Copy Number Variation Длинные повторы от 100 000 до 2, 2 млн. П. н. n Обнаружены в 255 областях n Обнаружена ассоциация с системной красной волчанкой, псориазом, ВИЧ. n

Диспергированные повторы SINE (short interspersed nucleotide elements) ДНК повторы 100 -400 н. п. Имеют Диспергированные повторы SINE (short interspersed nucleotide elements) ДНК повторы 100 -400 н. п. Имеют по краям короткие прямые повторы и poly(A)последовательность на 3‘ -конце n Alu-последовательности (Alu sequences) — длина около 300 п. о. Alu- повторы представлены в геноме человека ~106 копиями и в среднем встречаются через каждые 4000 п. о составляют 5% от суммарного количества ДНК Свое название это семейство повторов получило из-за присутствия в нем сайта рестрикции для эндонуклеазы Аlu I. n LINE (long interspersed elements) ДНК повтор -длина 6000 н. п. заключают в себе гены обратных транскриптаз В геноме человека было обнаружено только одно семейство повторов LINE - L 1 ( Hutchison et al, 1989 ). n Являются мобильными элементами генома

Мобильные генетические элементы Мобильные генетические элементы

Мобильные генетические элементы n n n 1. 2. 3. Барбара Мак. Клинток Мобильные генетические Мобильные генетические элементы n n n 1. 2. 3. Барбара Мак. Клинток Мобильные генетические элементы (МГЭ, Mobile genetic elements, MGE) — последовательности ДНК, которые могут перемещаться внутри генома. Открыты Барбарой Мак. Клинток в 1951 году выделяют несколько видов мобильных элементов (транспозонов) Инсерционные элементы ДНК- транспозоны ретротранспозоны

Мобильные генетические элементы У опоссума МГЭ составляют 52, 2% генома n у человека 45, Мобильные генетические элементы У опоссума МГЭ составляют 52, 2% генома n у человека 45, 5%, n у мыши — 40, 9%, n у собаки — 35, 5%. n У курицы лишь 9, 4% генома n

Способы транспозиции n n 1 «вырезать» - «вставить» - ДНК- транспозоны 2 «копировать» - Способы транспозиции n n 1 «вырезать» - «вставить» - ДНК- транспозоны 2 «копировать» - «вставить» - ретротранспозоны

Ретротранспозоны n n n Ретротранспозоны или мобильные элементы первого типа -перемещаются в геноме через Ретротранспозоны n n n Ретротранспозоны или мобильные элементы первого типа -перемещаются в геноме через РНК интермедиаты (посредника) Строение: По краям – повторы, в середине – гены обратной транскриптазы и интегразы. Механизм: Транскрипция РНК трансляция – синтез обратной транскриптазы и интегразы. Обратная транскриптаза синтезирует ДНК-копию ретротранспозона (на матрице его РНК), интеграза встраивает ее в геном хозяйской клетки.

Инсерционные элементы n Инсерционные последовательности, инсерционные элементы, IS-элементы (insertion sequences, IS-elements) — мобильные нуклеотидные Инсерционные элементы n Инсерционные последовательности, инсерционные элементы, IS-элементы (insertion sequences, IS-elements) — мобильные нуклеотидные последовательности генома прокариот длиной от 700 до 1500 п. н. , которые содержат на концах инвертированные повторы (несколько десятков п. н. ) и не содержат никаких генов, кроме тех, которые необходимы для их перемещения (транспозиции) по геному. В разных штаммах E. coli в геноме присутствуют 19 копий IS 1 -элементов.

Значение мобильных элементов n n n Повышают выживаемость генома Закрывают бреши в ДНК, если Значение мобильных элементов n n n Повышают выживаемость генома Закрывают бреши в ДНК, если не сработала репарация Регуляция активности гена Если встраиваются перед онкогеном, могут выполнять функцию промотора, то могут индуцировать канцерогенез n n Индуцируют хромосомные перестройки Эволюция геномов: Горизонтальный перенос генов (ретровирусы) между видами

Генный уровень n Ген - совокупность сегментов ДНК, которые вместе составляют экспрессируемую единицу, обусловливающую Генный уровень n Ген - совокупность сегментов ДНК, которые вместе составляют экспрессируемую единицу, обусловливающую образование специфического функционального продукта – молекулы РНК или полипептида. Гены Белок- РНК- кодирующие

 гены n n n Конститутивные гены или гены «домашнего хозяйства» (constitutive genes, housekeeping гены n n n Конститутивные гены или гены «домашнего хозяйства» (constitutive genes, housekeeping genes) экспрессируются постоянно, во всех клетках на всех этапах онтогенеза. Обеспечивают основные жизненные функции клетки. Кодируют синтез гистонов, t. РНК, r. РНК, ферментов метаболизма клетки: гликолиза, биосинтез аминокислот и нуклеотидов, катаболизм белков и т. п. экспрессия не регулируется дополнительными факторами (напр. , белком-репрессором), а определяется лишь взаимодействием РНК-полимеразы с промотором Регулируемые или гены «роскоши» (luxury genes) — экспрессируются в клетках определенных тканей и в определенное время. (напр. , гены иммуноглобулинов в В -лимфоцитах или гены глобинов в эритроидных клетках);

Некодирующие РНК Они составляют ¾ транскиптома ядра!!! Известно более 20 видов: 1. sn. RNA Некодирующие РНК Они составляют ¾ транскиптома ядра!!! Известно более 20 видов: 1. sn. RNA – малые ядерные РНК мя. РНК (участвуют в сплайсинге) Гены образуют кластеры 2. sno. RNA – малые ядрышковые РНК (участвуют в процессах модификации р. РНК, альтернативном сплайсинге, образовании субъединиц рибосом) 3. mi. RNA – микро. РНК (длина 21 -23 нуклеотида, участвуют в регуляции экспрессии генов путем блокирования трансляции) 4. si. RNAs (small interfering RNAs) – малые интерферирующие РНК (подавляют экспрессию генов путем деградации м. РНК) n

Длинные некодирующие РНК Long Non-coding RNA (lnc. RNA) Большой гетерогенный класс транскриптов длиной более Длинные некодирующие РНК Long Non-coding RNA (lnc. RNA) Большой гетерогенный класс транскриптов длиной более 200 нуклеотидов n Участвуют в регуляции экспрессии генов, синтезе теломер, импринтинге, инактивации Х-хромосомы, транспорте белков в ЭПС n

Структура генов кодирующих р. РНК n n Гены р. РНК объединены в кластеры. Один Структура генов кодирующих р. РНК n n Гены р. РНК объединены в кластеры. Один кластер содержит гены 18 S р. РНК, 5, 8 S р. РНК и 28 S р. РНК В спутничных районах акрицентрических хромосом (13, 14, 15, 21, 22 пары) кластеры расположены тандемно (друг за другом) в большом количестве копий. Между генами р. РНК и между кластерами расположены спейсеры (вставки), которые удаляются при созревании молекул р. РНК.

Белок- кодирующие гены Белок- кодирующие гены

Классификация белковых продуктов генов 1. Ферменты (около 30% генов) 2. Модуляторы функций белков (13, Классификация белковых продуктов генов 1. Ферменты (около 30% генов) 2. Модуляторы функций белков (13, 6%) (остальные классы менее 10% каждый) 3. Гормоны 4. иммуноглобулины 5. Транскрипционные факторы 6. Рецепторы 7. Белки внутри- и внеклеточного матрикса 8. Трансмембранные переносчики 9. Экстраклеточные переносчики 10. Структуры ионных каналов 11. Белки межклеточных сигналов

Классификация генов по функции Синтез РНК и белков -22% n Метаболизм – 17% n Классификация генов по функции Синтез РНК и белков -22% n Метаболизм – 17% n Деление клетки – 12% n Клеточные сигналы -12% n Защита клетки – 12% n Клеточные структуры 8% n Неизвестная функция 17% n

Роль мутаций генных продуктов в развитии наследственной патологии • Транскрипционные факторы манифестируют во внутриутробном Роль мутаций генных продуктов в развитии наследственной патологии • Транскрипционные факторы манифестируют во внутриутробном периоде, приводят к врожденным порокам развития (чаще аутосомно-доминантные) • Ферменты -манифестируют на первом году жизни (чаще аутосомно-рецессивные) • Рецепторы –от года до полового созревания • Модуляторы белковой функции –у взрослых

Структура белок- кодирующего гена • 1. Единица транскрипции - участок ДНК, кодирующий последовательность первичного Структура белок- кодирующего гена • 1. Единица транскрипции - участок ДНК, кодирующий последовательность первичного транскрипта: coding region - последовательность, кодирующая либо зрелую РНК, 2. 5' UTR, 3' UTR (untranslated regions ) 5’ лидерная и 3’ трейлерная либо белковый продукт 3. 4. последовтельности (транскрибируются, но не транслируются интроны спейсеры • 1. 2. 3. Регуляторные последовательности: для начала правильной транскипции (промоторы) для образования правильного 3’ конца зрелой РНК регулирующие частоту инициации транскрипции

Ген (эукариоты) • Первый и последний экзоны содержат не транслируемую последовательности ( соответственно 5’ Ген (эукариоты) • Первый и последний экзоны содержат не транслируемую последовательности ( соответственно 5’ -UTR) • и 3’-UTR) • Кодирующие участки- экзоны • Не кодирующие участки - интроны

РАЗМЕРЫ ФУНКЦИОНАЛЬНЫХ ГЕНОВ min 250 п. н. – max 2 200 000 п. н. РАЗМЕРЫ ФУНКЦИОНАЛЬНЫХ ГЕНОВ min 250 п. н. – max 2 200 000 п. н. <27 000 п. н. > ген IGF 2 - 250 н. п. - инсулин-подобный фактор роста II, 67 аминокислот ген дистрофина DMD - 2 220 223 н. п. , 79 экзонов, 3685 аминокислот, 8 промоторов

КОДИРУЮЩАЯ ЧАСТЬ Экзон - Последовательность ДНК, которая представлена в какомлибо из вариантов зрелой м. КОДИРУЮЩАЯ ЧАСТЬ Экзон - Последовательность ДНК, которая представлена в какомлибо из вариантов зрелой м. РНК Начало транскрипции Транскрипция Первичный транскрипт Сплайсинг Зрелый транскрипт

Размеры генов • В среднем ген содержит 8 экзонов • Min 1 экзон (гены Размеры генов • В среднем ген содержит 8 экзонов • Min 1 экзон (гены т. РНК, гистонов) • Max 364 экзона - TITIN (Титин — это самый большой из известных белов состоящий из 38138 аминокислот, входит в состав поперечно-полосатых мышц

Альтернативный сплайсинг Альтернативный сплайсинг

3‘ нетранслируемый участок поли(А) сайты и сигнальные последовательности полиаденилирования - защита м. РНК от 3‘ нетранслируемый участок поли(А) сайты и сигнальные последовательности полиаденилирования - защита м. РНК от деградации n сайты связывания микро РНК - подавление трансляции и запуск деградации м. РНК n

Регуляторные элементы Ø Промотеры - инициация транскрипции Ø Энхансеры/Сайленсеры - тканеспецифическое усиление/ослабление транскрипции Ø Регуляторные элементы Ø Промотеры - инициация транскрипции Ø Энхансеры/Сайленсеры - тканеспецифическое усиление/ослабление транскрипции Ø Инсуляторы - формирование структурных и функциональных доменов (блокировка энхансеров/сайленсеров) Ø Сайты связывания белков

ПРОМОТОР регуляторная последовательность в 5’ области гена, определяющая место прикрепления РНКполимеразы к ДНК и ПРОМОТОР регуляторная последовательность в 5’ области гена, определяющая место прикрепления РНКполимеразы к ДНК и интенсивность (частоту) считывания ТАТА бокс T 82 A 97 T 93 A 85 T 63 A 88 t 50 СААТ- домен (5’-GGCCAATCT-3’) GC - домен (5’GGCCGG-3’)

Взаимодействие РНК-полимеразы и транскрипционных факторов с промотором Взаимодействие РНК-полимеразы и транскрипционных факторов с промотором

Промотор РНК-полимеразы II и факторы транскрипции Промотор РНК-полимеразы II и факторы транскрипции

Энхансеры n n n Регуляторные элементы, стимулирующие транскрипцию Располагаются на расстоянии нескольких тысяч п. Энхансеры n n n Регуляторные элементы, стимулирующие транскрипцию Располагаются на расстоянии нескольких тысяч п. н. от гена (выше или ниже по течению), иногда в самом гене регуляция осуществляется через специальные белки, которые связываются с энхансером и транскрипционными факторами. ДНК при этом образует петлю

Инсуляторы (изоляторы) n n n Регуляторные участки размером около 40 п. н. Расположены между Инсуляторы (изоляторы) n n n Регуляторные участки размером около 40 п. н. Расположены между энхансером (сайленсером) и промотором или между кластерами соседних генов Определяют набор генов, на которые может влиять данный энхансер Защищают (изолируют) ген от влияния соседних промоторов и энхансеров (с помощью специальных белков, формирующих 3 D структуру ДНК)

Генные мутации Без сдвига рамки считывания Миссенс Нонсенс молчащие Со сдвигом рамки считывания Генные мутации Без сдвига рамки считывания Миссенс Нонсенс молчащие Со сдвигом рамки считывания

Мутации без сдвига рамки считывания Точковые мутации n n Замена одного нуклеотида в ДНК Мутации без сдвига рамки считывания Точковые мутации n n Замена одного нуклеотида в ДНК (ошибки при репликации): Молчащие Миссенс нонсенс.

Молчащие n Изменения нуклеотидной последовательности без изменения аминокислотной последовательности белка (Избыточность генетического кода) Молчащие n Изменения нуклеотидной последовательности без изменения аминокислотной последовательности белка (Избыточность генетического кода)

Миссенс мутации n n Замена одного нуклеотида, приводящие к замене одной аминокислоты Могут отражаться Миссенс мутации n n Замена одного нуклеотида, приводящие к замене одной аминокислоты Могут отражаться на структуре с свойствах белка (серповидноклеточная анемия), могут существенно не влиять

Нонсенс мутации n Изменение одного нуклеотида, приводящее к образованию стоп кодона Нонсенс мутации n Изменение одного нуклеотида, приводящее к образованию стоп кодона

Нонсенс мутации Образуется более короткий нефункциональный пептид Нонсенс мутации Образуется более короткий нефункциональный пептид

Мутации со сдвигом рамки считывания Frameshift mutation Добавление или потеря нуклеотидов: ¨ Инсерции (вставка) Мутации со сдвигом рамки считывания Frameshift mutation Добавление или потеря нуклеотидов: ¨ Инсерции (вставка) ¨ Делеции (потеря) ¨ Дупликации (удвоение) Изменяется вся аминокислотная последовательность после сайта мутации

Генная конверсия это прямой перенос фрагмента n n n Ген А и псевдоген В Генная конверсия это прямой перенос фрагмента n n n Ген А и псевдоген В обладают высокой гомологией, однако в псевдогене В накоплено значительное количество мутаций, а — спаривание гомологичных хромосом в мейозе; б — нарушение спаривания гомологичных хромосом: из -за высокой гомологии ген А «незаконно» выстраивается против псевдогена В; в — в результате генной конверсии происходит внедрение части псевдогена В в ген А. одного аллеля в другой аллель или фрагмента псевдогена в ген. В результате неправильного спаривания гомологичных хромосом и неравного кроссинговера происходит либо удвоение, либо исчезновение участка хромосомы, содержащего ген РМР 22, что является причиной развития болезни Шарко—Мари— Туса или наследственной нейропатии со склонностью к параличам от сдавления Большинство мутаций при адреногенитальном синдроме (врожденной гиперплазии коры надпочечников) — это последовательности псевдогена в гене 21 -гидроксилазы

Мутации сайтов сплайсинга n n n Мутации сайта сплайсинга возникают либо в ГТ-последовательности, характерной Мутации сайтов сплайсинга n n n Мутации сайта сплайсинга возникают либо в ГТ-последовательности, характерной для донорского 5'-сайта, либо в АГ-последовательности, характерной для акцепторного 3'сайта сплайсинга, либо в консенсусных последовательностях, которые прилежат к донорскому или акцепторному сайтам. Мутации сайта сплайсинга нарушают вырезание интронов из первичного транскрипта м. РНК, так что вырезается либо часть следующего экзона вплоть до той последовательности в экзоне, которая похожа на обычный сайт сплайсинга (криптический сайт сплайсинга), либо весь следующий экзон. В то же время в зрелую м. РНК может включаться часть или даже весь интрон. Пример: муковисцидоз

Экспансия нуклеотидных повторов увеличением числа повторов (чаще всего тринуклеотидных), но описаны также случаи увеличения Экспансия нуклеотидных повторов увеличением числа повторов (чаще всего тринуклеотидных), но описаны также случаи увеличения числа повторов, состоящих из 5 и даже 12 нуклеотидов, расположенных как в экзонах генов, так и интронах или даже нетранслируемых областях генов. Эти мутации называются динамическими, или нестабильными. Примеры: хорея Гентингтона, спинальная и бульбарная мышечная атрофия, типа 4 (1, 2, 3 и 6) спиноцеребеллярные атаксии, миотоническая дистрофия, атаксия Фридрейха, синдром ломкой хромосомы X

Изменение нуклеотидной последовательности Вариант нормы Мутация Внутри- и межвидовое разнообразие Наследственное заболевание (множественный аллелизм) Изменение нуклеотидной последовательности Вариант нормы Мутация Внутри- и межвидовое разнообразие Наследственное заболевание (множественный аллелизм) ? ? Для установления необходимы дополнительные исследования

Полиморфизм полиморфизм — отличия последовательности ДНК в геноме (или в другой сравниваемой последовательности) у Полиморфизм полиморфизм — отличия последовательности ДНК в геноме (или в другой сравниваемой последовательности) у представителей одного вида или между гомологичными участками гомологичных хромосом индивида. Виды: n По числу и распределению мобильных генетических элементов n По числу копий тандемных повторов (VNTR –variable number of tandem repeats) n Полиморфизм мини- и микросателлитов n ОНП - однонуклеотидный полиморфизм (Однонуклеотидные n замены) SNP Single nucleotide polymorphism

ОНП - однонуклеотидный полиморфизм Варианты последовательностей ДНК у разных людей с вовлечением одной пары ОНП - однонуклеотидный полиморфизм Варианты последовательностей ДНК у разных людей с вовлечением одной пары оснований n Частота 1: 600 -1200 нуклеотидов n Все гены содержат ОНП. В одном гене может быть до нескольких десятков вариаций. Кодирующая последовательность содержит в среднем 4 полиморфных сайта 50% ОНП – некодирующие 25% ОНП – синонимичные замены 25% ОНП – несинонимичные замены (миссенс) n Каждый человек гетерозиготен по 24 -40 тыс. несинонимичных замен!!!

Значение изучения ОНП n n ОНП используется для определения времени дивергенции человека с его Значение изучения ОНП n n ОНП используется для определения времени дивергенции человека с его далекими предками и поисками непосредственных предков (метод «молекулярных часов» ). Чем больше прошло времени с тех пор, как жил общий предок двух видов, тем длиннее период, в течение которого происходили эти изменения, и тем сильнее отличаются последовательности ДНК этих двух видов.

Значение полиморфизма Полиморфизм Не имеет патологического значения Показана ассоциация с НЕ моногенными болезнями Ассоциация Значение полиморфизма Полиморфизм Не имеет патологического значения Показана ассоциация с НЕ моногенными болезнями Ассоциация с моногенными болезнями Ген HERC 2 – Ген APOE – голубой цвет глаз атеросклероз Серповидноклеточная анемия

Полиморфизм микро- и минисателлитов n используются в медикогенетических и судебномедицинских целях. • характер расположения Полиморфизм микро- и минисателлитов n используются в медикогенетических и судебномедицинских целях. • характер расположения полос минисателлитных ДНК на электрофореграмме (ДНК — отпечаток) индивидуален практически так же, как и отпечатки пальцев, что позволило дать название методу — геномная дактилоскопия.

 Электрофореграмма амплифицированных фрагментов ДНК - аллелей хромосомного VNTR-локуса DIS 80 (1 р36 -р35) Электрофореграмма амплифицированных фрагментов ДНК - аллелей хромосомного VNTR-локуса DIS 80 (1 р36 -р35) трех индивидуумов n n а - истинная семейная группа - мать, ребенок и отец (1, 2 и 3, соответственно); б - ложная семейная группа - мать, ребенок и лжеотец; стрелкой отмечен отцовский аллель ребенка, который отсутствует в ДНК неродственного мужчины; М - стандарт молекулярных масс Alul-гидролизат ДНК плазмиды p. BR 322, приведены размеры в парах нуклеотидов

Полиморфизм длин рестрикционных фрагментов (ПДРФ) Restriction fragment length polymorphism (RFLP) n Это способ исследования Полиморфизм длин рестрикционных фрагментов (ПДРФ) Restriction fragment length polymorphism (RFLP) n Это способ исследования ДНК путем ее разрезания с помощью эндонуклеаз и дальнейшего анализа размеров образующихся фрагментов с помощью электрофореза представляют собой удобные генетические маркеры Анализируя родословные, можно проследить наследование аллелей этих маркеров в ряду поколений Это широко используется как для картирования геномов, так и для косвенной диагностики наследственных заболеваний, для выявления гетерозиготного носительства. Маркеры позволили создать генетическую карту человека при изучении родословных. Определив генотипы всех членов родословной, можно установить сцепление данных маркеров с геном заболевания.

Наследование аллелей полиморфного маркера D 4 S 412 в семье с аутосомнодоминантным наследственным заболеванием Наследование аллелей полиморфного маркера D 4 S 412 в семье с аутосомнодоминантным наследственным заболеванием