From the conception of the PRINS to its

From the conception of the PRINS to its coronation Régen DROUIN, Geneticist MD, Ph. D, FACMG, FCCMG Department of Medical Genetics, CHUS & Department de Pediatrics, Université de Sherbrooke, Quebec, Canada

Cytogenetics: - Chromosome Cytogenetics - Interphase Cytogenetics - Conventional Cytogenetics - Molecular Cytogenetics Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Molecular Cytogenetic Techniques available: - FISH (Fluorescence In Situ Hybridization) & variants: Q-FISH, express FISH, etc. - PRINS (PRimed IN Situ labeling) - M-FISH (Multicolor-FISH) or SKY (spectral Karyotype) - Band-FISH - CGH (Comparative Genomic Hybridization) Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

PRINS PRimed IN Situ labeling Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

PRINS: Beginning l PRINS technique was introduced in 1989 by Koch & al. Dept of Cytogenetics, Société Danoise du Cancer. Aarhus, Danemark l Ref. Koch J, Kolvraa S, Petersen K, Gregersen N, Bolund L, Oligonucleotide-priming methods for the chromosomespecific labelling of alpha satellite DNA In Situ. Chromosoma 1989; 98: 259 -65 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

PRINS: HISTORY l Method described 15 years ago, that was applied to respond to questions regarding the structure of the minute chromosomes in the primate -satellite DNA sequence. l Development and Applications of PRINS (many variants of the technique have been described) l There are more and more targets investigated using PRINS (many species: animals and plants) Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

l Multi-PRINS and Blocking step, l Dual-color PRINS without blocking step l New strategy for triple-color PRINS l Nucleotids labeled with Bio-d. UTP & Dig-d. UTP l Omission of blocking step l Creating new color by mixing colors Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Extended section of chromosome Chromatin fiber of packed nucleosomes‘String-of-beads’ DNA double helix form of chromatin Condensed section of chromosome 10 nm 700 nm 300 nm 1 400 nm 2 nm DNA Condensation and fiber. FISH

A good PRINS method should have: - An extremely high specificity (extremely low background) - A good sensitivity (good hybridization efficiency) - Unambiguous recognition of the hybridization signal Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

PRINS Annealing Elongation Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada MB

PRINS targets : - Metaphase Chromosomes - Interphase Nuclei - Fixed Tissues - Cells in culture Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

METHOD Chromosome banding • Slide preparation and thermocycler • Add Taq polymerase to the reaction solution • Put the mix solution on the slide + cover slip Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

METHOD Add Taq polymerase to the reaction solution Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

METHOD Put the mix solution on the slide + cover slip support thermocycler

METHOD Detection & visualisation • Washings post-PRINS • Detection using a labeled antibody • Washing of the antibody + counterstaining • Observation under a fluorescence microscope Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Applications of the PRINS technique: - Identification of chromosomes - Aneuploidy detection - Analysis centromere DNA - Identification of markers Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Proportions (%) of nuclei carrying two signals of chromosome 8 Comparison of PRINS with FISH in the detection of interphase nuclei carrying two signals of chromosome 8 in 16 control cases 120 100 80 60 PRINS 8 FISH 8 40 20 0 1 2 3 4 5 6 7 8 9 Cases 10 11 12 13 14 15 16 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Proportions (%) of nuclei carrying two signals of chromosome 7 Comparison of PRINS with FISH in the detection of interphase nuclei carrying two signals of chromosome 7 in 16 control cases 120 100 80 60 PRINS 7 FISH 7 40 20 0 1 2 3 4 5 6 7 8 9 Cases 10 11 12 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada 13 14 15 16

Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

A B PRINS 7 FISH 8 PRINS 8 D FISH 7 C E Dual-PRINS 7 (red) and 8 (green) Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada F

l l The development of molecular cytogenetics such as FISH and PRINS are especially important for the study of hematologic disorders. With these approaches, not only dividing cells, but also nondividing cells can be studied for chromosome identification. PRINS technique is a good alternative to FISH to identify chromosomes both in metaphase and in interphase nuclei. Our results showed no significant difference between these two techniques regarding detection sensitivity and specificity. PRINS is more cost-effective, easier and faster than FISH. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

• Samples preparation: usual techniques • PRINS reaction and detection solutions for three chromosome targets: System Labeling-chromosome Detection mix 1 Bio- 7 Dig- 8 Bio- 18 Avidin-fluorescein/ Anti-dig-rhodamine 2 Dig- 7 Bio- 8 Dig- 18 Anti-dig-fluorescein/ Avidin-rhodamine • Triple-PRINS programming: 1 st cycle: 62. 5 C, 10 min with first label, wash in PBS 2 min 2 nd cycle: 62. 5 C, 10 min with second label, wash in PBS 2 min 3 rd cycle: 62. 5 C, 10 min with third label, wash in wash buffer 2 min • Detection, Counterstain and image analysis

The results of triple-PRINS using two different labeling orders combined with two different detection systems Detection system 1 a Detection system 2 b Labeling order 1 st signal 2 nd signal 3 rd signal 1. bio-dig-bio Yellow Red Green 2. dig-bio-dig ambiguous Yellow Red a: Mix of avidin-fluorescein/anti-dig-rhodamine; b: Mix of anti-dig-fluorescein/avidin-rhodamine. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada Green

Primers Name Chromosome Sequence Reference -7 8 c 18 c 7 GCTTGAAATCTCCACCTGAAATGCCACAGC Koch et al. 1995 8 CTATCAATAGAAATGTTCAGCACAGTT Pellestor et al. 1996 18 ATGTGTGTCCTCAACTAAAG Pellestor et al. 1995 Xc D 599 D 600 X GTTCAGCTCTGTGAAA Pellestor et al. 1995 Y TGGGCTGGAAAGGAATCGAAAC Speel et al. 1995 Y TCCATTCGATTCCATTTTTTTCGAGAA Speel et al. 1995 Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

A: bio-dig-bio labeling order with detection system 1 The first PRINS reaction 3’ 5’ The second PRINS reaction 3’ 5’ The third PRINS reaction 3’ 5’ The first PRINS site on chromosome 7 The second PRINS site on chromosome 8 The first PRINS site on chromosome 7 The third PRINS site on chromosome 18 5’ 5’ 3’ 3’ 3’ 5’ : Chromosome DNA; : The first primer; : d. NTP; The second PRINS site on chromosome 8 The first PRINS site on chromosome 7 : Biotin-d. UTP; : The second primer; : Digoxigenin-d. UTP; : The third primer;

B: dig-bio-dig labeling order with detection system 2 The first PRINS reaction 5’ 5’ The second PRINS site on chromosome 8 5’ 3’ The first PRINS site on chromosome 7 The second PRINS reaction 3’ 3’ The third PRINS reaction 3’ 5’ The third PRINS site on chromosome 18 5’ 5’ 3’ 3’ 3’ 5’ : Chromosome DNA; : The first primer; : d. NTP; The second PRINS site on chromosome 8 The first PRINS site on chromosome 7 : Biotin-d. UTP; : The second primer; : Digoxigenin-d. UTP; : The third primer.

bio-dig-bio labeling, avidin-fluorescein/ Department of Medical Genetics, CHUS & Department of Pediatrics, Université anti-dig-rhodamin detection de Sherbrooke, Quebec, Canada

bio-dig-bio labeling, avidin-fluorescein/ anti-dig-rhodamin detection

bio-dig-bio labeling, avidin-fluorescein/ Department of Medical Genetics, CHUS & Department of Pediatrics, Université anti-dig-rhodamin detection de Sherbrooke, Quebec, Canada

dig-bio-dig labeling, anti-dig-fluorescein/Department of Medical Genetics, CHUS & Department of Pediatrics, Université avidin-rhodamin detection de Sherbrooke, Quebec, Canada

Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

XY normal <==Multi-PRINS FISH==>

47, XX, +18 <==Multi-PRINS FISH==>

Main advantages of the PRINS technique: * * * * Semi-automated Protocole because of thermocycler Simple, reproducible and reliable method Very good ratio cost benefit Short duration of the reaction (on the average) Availability of any primers (automatic synthesizer) The specificity and small size of the primers (18 à 35 mer) does not generate cross reaction Specificity of centromeric sequences of chromosomes 13 and 21 More efficient in some cells with more condensed nuclei: the size of primer is much smaller than the size of the probe thus making it easier to pass the nuclear membrane and hybridize to the target DNA Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Main advantages of the PRINS technique: * * Detection of unique intragenic sequences Very low background because of the absence of labeling directly on the primer and the rapidity of the reaction Good preservation of the integrity of the chromosome structure due to the short incubation time Multi-target detection: it is very easy to do multi-color PRINS or combine with FISH to simultaneously detect different chromosomes in the same cells. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

CONCLUSIONS ØTechnique PRINS Powerful technique, simple and universal Represents a very good alternative to FISH ØFuture Perspectives Detection of fusion genes Detection of female foetal cells using the technique of PRINS-RNA Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Applications of the FISH and PRINS techniques: - Identification of chromosomes - Détection of aneuploïdies - Analysis of centromeric DNA - Identification of marker chromosomes Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

A good PRINS method should have: - An extremely high specificity (extremely low background) - A good sensitivity (good hybridization efficiency) - Unambiguous recognition of the hybridization signal Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Same nucleus in both panels is shown with the opposite colours Simultaneous FISH analysis using sex chromosome Simultaneous reverse FISH analysis using specific probes: the red signal correspond to the sex chromosome specific probes: the red X chromosome and the blue signal to the Y signal correspond to the Y chromosome and chromosome the blue signal to the X chromosome

FISH technique (LSI-21 probe) combined to PRINS reaction (Y primer sequence) Male fetal cell with 3 copies of Chromosome 21 (red signals) and 1 copy of the Y chromosome (green signal)

PRINS technique Male fetal cell with trisomy 18

Fetal cell with trisomy 18 detected by PRINS technique

Fetal triploid cell detected by PRINS technique using centromeric oligonucleotide primer specific to the PRINS (primer centromeric oligonucleotide 8 chromosome 7 (the nucleus with three red signals) Fetal cell with triploidy

PRINS technique Triploidic fetal cell with 3 copies of chromosome 7

CONCLUSIONS Ø It is possible to detect fetal cells in every pregnant woman during the pregnancy. Using molecular cytogenetic approaches, (FISH and PRINS), we showed that there were between 2 and 6 fetal cells per m. L of maternal blood Ø The low fluctuation between the 12 pregnant women we studied is likely due to personal characteristics specific to each of the women. Ø The number of fetal cells in the maternal blood does not appear to be influenced by previous pregnancies.

CONCLUSION Ø It is possible to detect fetal cells between millions of maternal blood cells (our previous results : 2 to 6 fetal cells per m. L of maternal blood, see ref. 3) using molecular cytogenetic techniques (FISH et PRINS) Ø In agreement with several reports, our preliminary results obtained with 14 pregnant women show a 5 -fold higher number of fetal cells in pregnancies associated with aneuploid conceptuses (see Tables 1, 2 & 3) Ø This finding provides an interesting perspective for the development of a safe and convenient non-invasive molecular cytogenetic prenatal diagnosis for the most common fetal chromosomal aneuploidies (13, 18, 21, X and Y). Ø However, this procedure is time consuming and labour intensive. More studies are needed to confirm the robustness of this methodology and automation will be required before widespread application. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Telomere Simple DNA sequence (T 2 AG 3) tandemly repeated, of variable length, located at the extremities of the chromosomes. Telomeres are essential elements that protect the extremities of the chromosomes from degradation and ligation. Shortening Incomplete Replication Nuclease Activity Equilibrium Elongation Addition of repetitions T 2 AG 3 by the telomerase Senescence Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Telomeres • Specialized structures made of DNA and PROTEINS • Repeated DNA sequence: 2 à 15 kb • Maintain the chromosome stability TTAGGGTTAGGG AATCCCAATCCC • Around 30 to 120 bp are lost per somatic cell division • Too short : cellular senescence and genetic instability Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Measurement of telomeres Average length of telomeres : • Measurement of terminal restriction fragments. – Digestion using restriction enzymes of purified DNA – Visualization and measurements of telomeric fragments by Southern blot • Cleavage of telomeres at variable distance • No information individual telomeres Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Measurement of telomeres Length of individual telomeres : Quantitative FISH (Q-FISH) Hybridization telomeric PNA probes Measurements of the signal intensity Length Profil of individual telomeres Variation of hybridization efficiency ? ? ? Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

The PRINS reaction PRINS Marquage par synthèse in situ amorcée Appariement The primer sequence is complementary to the telomeric sequence: (CCCTAA)7 Élongation Tissus Koch et al. , 1995 Terkelsen et al. , 1995 Cellules Chromosomes Fibres d’ADN

Figure 3: Wrn ∆hel/ ∆hel 11 -d. UTP-digoxigénine Department of Medical Genetics, CHUS & Department of Pediatrics, 62. 5 °C, 10 minutes Université de Sherbrooke, Quebec, Canada

Le double-PRINS • To increase the efficiency of the telomere labeling using PRINS, Dr Ju Yan developed an innovative doublelabeling technique : two complementary primers, (CCCTAA)7 et (TTAGGG)7, are used to label both DNA strands of the telomere sequences. : (TTAGGG)7 A A : (CCCTAA)7 C B B C Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Materials & méthods PRINS Reaction 1. The PRINS mixture is put on the slide : d. NTP, labeled d. UTP (biotine or digoxigenine), primers, Taq buffer & Taq polymerase 2. Hybridization and elongation : 20 minutes at 63°C, 3. on a thermocycler.

Materials & methods Double-PRINS Procedure 1. 1 st PRINS reaction : primer (CCCTAA)7. 2. Brief washings (washing buffer then PBS 1 x ). 3. 2 nd PRINS reaction : primers (TTAGGG)7. 4. Washings (washing buffer : 5 min. at 45 o. C and 2 x 5 min. at room To). 5. Revelation of the signals : fluorescent antibodies. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Materials & methods Image Analysis 40 metaphases per case, 10 for each type of signals : - green signals only - red signals only - double color signals - double green signals Analyzed using the ISIS 2 software of Metasystems Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Results 1. Comparison between simple PRINS and PNA-FISH One PRINS cycle PNA-FISH Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Results 2. Double-PRINS double color

Results 3. Comparison between simple PRINS and double-PRINS Green only Red only Double color

Results 4. Comparison between double-green double-PRINS & PNA-FISH Double-vert PNA-FISH Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Results Vert Rouge Double PNA couleur vert Marquage des chromatides Marquage des bras des chromosomes Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Telomere signals on chromatin fibers (arrows) detected by double-green labelling using PRINS. Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada

Fig. 4: Single-copy sequence detected by multi-primer PRINS technique. Locus: AL 672294, 37 kb on chromosome 1 q subtelomere, 28 primers. Labeling: Biotin-d. UTP Detection: Avidin-FITC

Team of Dr Régen DROUIN Cytogenetics Molecular Genetics • Walid DRIDI Macoura GADJI Kada KRABCHI Josée LAVOIE • Éric BOUCHARD • Sandrine LACOSTE Stéphane OUELLET Patrick ROCHETTE François VIGNEAULT Marc BRONSARD • Ju YAN • Nathalie BASTIEN Mélissa FERLAND Isabelle PARADIS Department of Medical Genetics, CHUS & Department of Pediatrics, Université de Sherbrooke, Quebec, Canada