Forensic DNA Analysis Created by: Mrs. Ryan Modifications and additional material by: Mrs. Toth 1
What does forensic DNA analysis tell us? A successful DNA profile allows one to conclude that a DNA sample came from a specific individual. 2
Why analyze DNA ? 3
What is DNA? • It is a polymer (repeating nucleotides*) made of repeating units. • DNA occurs in 2 locations in cells: - nucleus - mitochondria *Nucleotide: A, T, C, or G with a phosphate and sugar attached 4
Nuclear DNA • Structure discovered in 1953 by Watson and Crick. • Basic building blocks are called nucleotides. Bases: A, G, T, C 5
• The nucleotides are arranged in two strands, held together by hydrogen bonds between the bases. Ladder-like shape. Note base pairing rule: A-T C-G - In RNA, “A” goes with “U” (uracil) 6
• The “ladder” twists, forming the famous double helix. 7
• In humans, nuclear DNA exists as 46 chromosomes (23 from each parent). maternal paternal 8
The human genome consists of : 3 billion base pairs 9
• Within the genome, there are only 25, 000 to 30, 000 genes (< 1%) which code for proteins. • Therefore, 99% of our genome is noncoding. (No longer called “junk DNA”) - these non-coding regions display a lot of variation person to person. * this is ideal for identification purposes ! 10
Polymorphisms • These variable regions are called polymorphisms: areas variable in length and # of repeated base sequences • Polymorphisms are inherited and unique among individuals • They always occur in pairs 11
Genotype: 12 -17 12
Specific Type of Polymorphism • STRs (Short Tandem Repeats) - repeated sequences 2 -8 bases long - because they’re so short, can use very small or degraded samples 13
maternal paternal Genotype: 7 -8 14
Goal of STRs Trying to see how many times a particular pattern of nucleotide repeats on the chromosome of an individual • • Since this number varies, makes it unique to each individual • FBI looks for 13 specific STRs to analyze for profiling 15
How to Analyze DNA: RFLP or PCR 16
For any type of DNA analysis: First obtain DNA samples and isolate DNA 17
RFLP Method (Restriction Fragment Length Polymorphisms) • First DNA typing method: developed in 1985 by Alec Jeffries. (Colin Pitchfork case) 18
RFLP Procedure: 1. Isolated DNA is cut with restriction enzymes. - these enzymes recognize particular base sequences and cut the DNA at that location, creating fragments (RFLPs). *Special note: This is different from STRs!! 19
Example: the enzyme Bam. HI recognizes: GGATCC Cuts here Where will the enzyme cut this DNA ? TCGTGGATCCCAATTGGTCGATCGGATCCCAT TCGTG Short fragment End result: 3 fragments GATCCCAATTGGTCGATCG long fragment GATCCCAT Shorter fragment 20
2. Separate DNA fragments into bands using electrophoresis. - DNA fragments are loaded into wells in an agarose gel - an electric current is applied and the fragments move to the (+) charge -smaller fragments move faster and farther, larger move slower and travel less animation 21
A sample gel: Longer fragment What are you looking at? Shorter fragment -Each column is a different person -Each line is a different size chunk of DNA that was cut by enzymes -How these pieces of DNA are cut is different for each person 22
animation 23
24
The Green River Killer: Old vs. New Technology • A notorious serial killer. From 1982 -1991, nearly 50 murders were attributed to him. • In 1987, saliva samples were taken from Gary Ridgeway, a suspect. • Semen samples from victims didn’t give enough DNA for testing; so samples were stored • In 2001, newer STR and PCR analysis was used and generated a match. 25
Modern DNA Profiling (what we do now) • Analyzes 13 specific STR locations 26
Recall: maternal chromosome paternal chromosome This person’s genotype for this STR locus is 7 -8 27
• These STRs can be selected and copied using a technique called PCR. • Only a trace amount of DNA is needed • Polymerase Chain Reaction produces millions of copies of a sequence of DNA (like an STR) in a short period of time. • There is now enough DNA to be R analyzed an ST ying cop photo nce! e It’s lik ll seque a or sm 28
• PCR was invented in 1983 by Kary Mullis, who won the Nobel Prize in 1993. • This procedure is essentially an automated version of how DNA naturally replicates or copies itself. 29
DNA replication in your cells • Cells replicate their DNA prior to cell division to ensure each daughter cell gets an identical copy of the DNA. d Ori n stra g. unzi pped ds ran st ew d N e form e s at e nd i p 2 co animation 30
PCR: DNA replication gone wild in a test tube ! • It’s beauty is its simplicity. • All that is needed: - DNA template strand - DNA polymerase (Taq) - enzyme that reads DNA and starts replication - primers (for the STR) - little strands of DNA that mark where you 31 start replication
STR to copy is highlighted 1. 2. 5. repeat 3. 4. PCR song PCR virtual lab 32
o of n m k de licatio nd c Qui ; rep ’e e 3 R PC s at th t star Mullis animation 33
• Now the copied / amplified STRs can be analyzed using electrophoresis. STR alleles Allele ladder S 1 S 2 There will be 2 bands on the gel for each person. This gives you the person’s genotype for that STR. 13 STRs are analyzed to individualize the DNA sample. 34
CSI : PCR Basics Lab: Lesson 2 e STR on is for el This g umn n! regio ds per col mom, one n - 2 ba e one from s becau d da from 35
# of repeats This is what your gel should look like… One line on a gel would mean the individual is “homozygous” for that STR 36
The power of discrimination 37
• A random probability match for the profile can be calculated by multiplying the frequencies of each of the 13 STRs. 38
What a modern DNA profile looks like! - Like electrophoresis within a computer Probability of having this STR 39
When the random match probability is done using all 13 STRs… it calculates that only one person in every quadrillion (million billions) will have this STR profile !!!!! ( this number is more than the estimated number of humans that ever lived ) Would you consider this individualized evidence ? 40
Unusual circumstances… Human chimeras • Have two distinct sets of nuclear DNA in their cells • Are very rare • May not be identified accurately using DNA 41 profiling
• Occur naturally when fraternal twin embryos fuse early on in development, resulting in one fetus with 2 different genetic profiles. May have symptoms such as 2 different 42 colored eyes
• Can arise due to transplants, such as bone marrow transplants. -the marrow recipient would have two different DNA profiles: marrow and blood would have the DNA profile of the donor; skin, hair, etc. would have the DNA profile of the recipient. How could a Forensic DNA analyst attempt to avoid issues due to chimerism ? Obtain samples from several different tissues 43
CODIS COmbined Dna Index System to de rimes li s c his fying ho t e rov quali ple w Imp ude peo l inc more of: databases ODIS and in C are (qualifying • Local, state and national - convicted offenders offenses differ state to state) link - unsolved crime scene evidence - unidentified remains - relatives of missing persons 44
• Running convicted offenders database against the unsolved CSI database helps to : - identify serial offenders - identify suspects Due to the potential benefits from these databases due to recidivism rates (relapsing into crime), many states are looking to expand the convicted offenders database. 45
Limitations: Ø Due to the volume of samples, there is a backlog in processing DNA samples to enter into the databases. Ø This backlog is increasing as states expand their convicted offender legislation 46
What about using the databases to analyze old unsolved cases ? • Must take into account: - already have a backlog -statutes of limitations (after a certain number of years, a crime cannot be tried) - condition of evidence (packaged, stored properly, chain of custody maintained? ) - availability of witnesses (can they be located; do they want the case brought up? ) 47
What conditions do you think should mandate whether a person’s DNA be included in CODIS ? 48
Mitochondrial DNA (mt. DNA) • Mitochondria are the energy producing organelles of the cell • There are 2000 per cell, each containing DNA 49
• mt. DNA is in the form of loops rather than chromosomes. 50
• mt. DNA is passed from a mother to her offspring. 51
• mt. DNA is passed virtually unchanged generation after generation (has a low mutation rate). your mt. DNA identical mt. DNA from your maternal ancestors from 1000 years ago 52
53
• Because mt. DNA is more abundant than nuclear DNA, it remains long after nuclear DNA breaks down. Therefore it’s useful in identifying… - remains of people that died long ago - charred remains mt. DNA can be extracted from bones & teeth 54
mt. DNA Analysis: • Is time consuming & costly • Requires reference samples from maternal relatives when making an identification • Is not as individualized as nuclear DNA since maternal relatives all share their mt. DNA 55
• Two hypervariable segments are amplified using PCR and then sequenced. • These sequences are then compared to a maternal reference sample or entered into a database. 56
The Boston Strangler Albert De. Salvo: True Confessions? Video link 57
Скачать презентацию Forensic DNA Analysis Created by Mrs Ryan Modifications
eafca566e7c1597ef8e1f0c9c017a54c.ppt