DISCOVERING PHYLOGENY Delving into Cells Chromosomes and Genes

DISCOVERING PHYLOGENY Delving into Cells, Chromosomes and Genes. Student activities are shown in yellow Write answers on your worksheet 1

Discovering Small Differences Which inherited trait do you have? Click and Fill in your worksheet as you determine each one. Pull your hair back. Widows peak or none? Cross your arms…. are you left over right over left? Earlobes Attached or unattached? Second toe longer or shorter than your big toe? Mid-digit hair on fingers? 2

Fill in the stars to look at some inherited characteristics Use the pictures on the previous slide to help you 3

WE ARE DIFFERENT IN MANY WAYS, BUT IN MANY WAYS WE ARE THE SAME! I wonder how, I wonder why I’m 61% like a fly? Now here’s a shock that’s sort of grouse We’re 99% like a mouse! It makes you stop, it makes you think How similar are we to a chimp? Source: Mouse http: //animals. timduru. org/dirlist/mouse. jpg Drosophila: http: //www. innate. se/drosophila. jpg Chimpanzee: http: //www. utalii. com/Hotels/images/Chimpanzee. jpg 4

Can you guess which photos belong to a developing pig, tadpole, human and chicken? Click to reveal the developing embryos. Did you guess correctly? Animals with a backbone look similar in early development. They all have many similar structures when they are mature as well. Let’s explore this further. Pictures from Nova Online 5

You have trillions of cells in your body! 1 Red blood cells to carry oxygen around the body And White blood cells to fight infections 2 Nerve cells send electrical signals so your brain can communicate with the rest of the cells in your body 3 Fat Cells to store excess energy 4 Muscle cells for movement Here are some examples of cells in your body. Can you guess what they are and what they do? Click on them to check your answer. 5 Source: Blood cells: http: //images. encarta. msn. com/xrefmedia/sharemed/targets/images/pho/35 a 5 c/35 A 5 C 297. jpg Nerve cell: http: //www. technovelgy. com/graphics/content/nervecell. jpg Fat cells: http: //casweb. cas. ou. edu/pbell/Histology/Images/Slides/Connective/pl. skin. adipose. jpg Muscle cells: http: //www. meddean. luc. edu/lumen/Med. Ed/Histo. Images/hl 3 A-42. jpg Bone cell: http: //www. meddean. luc. edu/lumen/Med. Ed/Histo. Images/hl 4 A-40. jpg Bone cells produce calcium carbonate to support the body 6

DNA is in the cell nucleus All mature cells contain DNA except your red blood cells. DNA is found in the nucleus. This is a large structure found in the cell. Can you locate it in the cell below? Click to check your answer. Nucleus 7 Source: http: //www. tokyo-med. ac. jp/genet/picts/cell-e. jpg

DNA is packed into chromosomes You have 46 chromosomes in each of your body cells. You inherited these from your parents: 23 from mum and 23 from dad Click on the button to see what your chromosomes look like. The chromosomes you inherit determine what you look like. Human chromosomes Source: Chromosome: http: //data. over-blog. com/lib/0/4/3540/pics/Articles/chromosome. jpg 8

Fertilisation Event An egg has 23 chromosomes and a sperm has 23 chromosomes. The cell that results from fertilisation contains 46 chromosomes or 23 pairs. 9

Embryo Development All of your body cells come from this one fertilised cell. Every time cells divide they copy their DNA and pass it on to their daughter cells. Embryo Development This means that all of your body cells have the same copy of DNA or the same chromosomes as the original cell. Cells end up doing different jobs because of the genes that are turned Pictures from Nova Online on or off. 10

Genes Sections of the chromosome shown here have been coloured in. Each section is a piece of DNA called a gene. A gene acts as a recipe or code for making a protein. Look at some genes on your chromosomes. Click on Tour and then “Genome spots” Source: Chromosome: http: //academy. d 20. co. edu/kadets/lundberg/dnapic 2. html 11

WHAT ARE PROTEINS? WHY ARE THEY SO IMPORTANT? 70% of your body is water. 15% is protein! Many parts of your body are built out of proteins! Many parts of your body are built by proteins! You drink to get water and you eat food containing protein to get the building blocks for making proteins. The building blocks are amino acids. You’ve all used lego pieces or blocks to build things. In a similar way, your body builds proteins out of amino acids Source: http: //thehumanbodyfilm. com/home. html 12

1. Amylase – a protein in your saliva that breaks down starch (found in biscuits, cereal, bread, etc. ) into smaller sugars 2. Two proteins for muscle movement – actin and distrophin 3. Another protein found in muscle is myoglobin. It stores the oxygen needed for cells to do their work 4. Keratin – a protein that makes your nails and hair tough Proteins in You! 5. Your heart pumps blood. The blood contains red blood cells. These red blood cells contain the protein haemoglobin. Haemoglobin carries oxygen to cells all around the body. 6. All of your joints contain tendons to join bones and cartilage to stop bones rubbing together and to absorb shock. The protein here is collagen – a tough and flexible protein. 13

So…we’re all so similar because of our genes and the proteins we make! But what is a gene made out of? ? ? The molecule of life…. DNA 14

What does DNA stand for? De oxy ribo Nucleic Acid Missing or less Oxygen Sugar Nucleus Acid (think Ribena!) (part of your cells) (think lemons and oranges!) 1. PRACTICE SAYING ‘DEOXYRIBONUCLEIC ACID’ BY BREAKING IT DOWN INTO SMALLER PARTS. THESE PARTS GIVE YOU CLUES ABOUT THE MOLECULE. 2. TRY TO GUESS WHAT EACH PART MIGHT MEAN AND THEN CLICK TO CHECK YOUR ANSWER (Do this in order) 15

Would you eat DNA? All living things are made up of cells. Do you think that plant cells contain DNA? Let’s investigate…. . DNA extraction protocol 16

DNA is made up of two strands (shown here in blue and red). The strands are held together by nitrogen bases (shown here in yellow) There are four nitrogen bases: Cytosine, Guanine, Adenine and Thymine What pairs with C? What pairs with A? http: //academy. d 20. co. edu/kadets/lundberg/dnapic 2. html http: //www. tokyo-med. ac. jp/genet/picts/dna. jpg 17

These are the building blocks of DNA. They all have different shapes. We call them A, T, G, and C for short. In a strand of DNA, A can only fit with T, and G can only fit with C. Choose a different colour for each base, and colour them in. Look at the strand of DNA above. Colour and label the bases along it. Now draw the bases on the matching strand of DNA. Remember! A and T go together, and G and C go together! DNA replication Click on Copying the Code Then putting it together Then Replication 18

The code In each gene (length of DNA) there is a code for making protein. The code is determined by the order of the nitrogen bases A, T, G and C. The code is copied and then read by your cell machinery so proteins can be made. This is called gene expression 19

A gene for keratin, the protein your hair is made out of, is located on chromosome 12. How many nitrogen bases make up the coding part of this gene (shown below)? 1 ccctgcactt gggagccggt agcactccta tcactgcttc tcaacccgtg agctaccagc tgtgtcatga gctgcagaca gttctcctcg tcctacttga gccgcagcgg cgggggtggc gggggcggcc tgggcagcgg gggcagcata aggtcttcct acagccgctt cagctcctc gggggcggtg gaggaggggg ccgattcagc tcttctagtg gctatggtgg gggaagctct cgtgtctgtg ggagg cggtggcagt tttggctaca gctacggcgg aggatctggg ggtggtttta gtgccagtag tttaggcggt ggctttgggg gtggttccag aggttttggt ggtgcttctg gaggaggcta tagtagttct gggggttttg gaggtggctt tggtggtggt tctggaggtg gctttggtgg tggctatggg agtgggtttg gggggtttgg gggctttgga ggtggtgctg gaggaggtga tggtggtatt ctgactgcta atgagaagag caccatgcag gaactcaatt ctcggctggc ctcttacttg gataaggtgc aggctctaga ggaggccaac aacgacctgg agaataagat ccaggattgg tacgacaaga agggacctgc tgctatccag aagaactact ccccttatta taacactatt gatgatctca aggaccagat tgtggacctg acagtgggca acaacaaaac tctcctggac attgacaaca ctcgcatgac actggatgac ttcaggataa agtttgagat ggagcaaaac ctgcggcaag gagtggatgc tgacatcaat ggcctgcggc aggtgctgga caatctgacc atggagaagt ctgacctgga gatgcagtat gagactctgc aggaggagct gatggccctc aagaagaatc ataaggagga gatgagtcag ctgactgggc agaacagtgg agatgtcaat gtggagataa acgttgctcc tggcaaagat ctcaccaaga ccctcaatga catgcgtcag gagtatgagc agctcattgc taagaacaga aaggacatcg agaatcaata tgagactcag ataacccaga tcgagcatga ggtatccagt agtggtcagg aggtgcagtc cagtgccaag gaggtgaccc agctccggca cggtgtccag gagttggaga ttgagctgca gtctcagctc agcaagaaag cagctctgga gaagagcttg gaagacacga agaaccgcta ctgtggccag ctgcagatga tccaggagca gatcagtaac ttggaggccc agatcactga cgtccggcaa gagatcgagt gccagaatca ggaatacagc cttctgctca gcattaagat gcggctggag aaggaaatcg agacctacca caacctcctt gaggcc aggaagactt tgaatcctcc ggagctggaa aaattggcct tggaggtcga ggaggaagtg gaggcagtta tggaagagga tccaggggag gaagtggagg cagctatggt ggaggaggaa gtggaggtgg ctatggtgga ggaagtgggt ccaggggagg aagtggaggc agctacggtg gaggaagtgg ttctggagga ggtagtggag gtggctatgg tggaggaagt ggaggtggcc atagcggagg aagtggaggt ggtcatagtg gaggaagtgg gggcaactat ggaggaggaa gtggctctgg aggaggaagt gggggtggct atggtggagg aagtgggtcc aggggaggaa gtggaggcag ccatggtgga ggaagtggtt ttggaggtga aagtggaggc agctacggag gcggtgaaga agcgagtgga agtggtggcg gctacggagg aggaagcgga aaatcatccc attcctagtc ttcttcctca aaatctggtg accaagatga gacaaaaggc ttcctttcgc gatactagag cctctgtaaa cttctcctgc ccagccccag ctgagcatcc ccagatgggc agactcccga tgaagcctgc ttattggatc ctgacatcag gaatagctgg caacaagccc ctgtgcccgt ttgggactgacttgg catatgtgcc tctggctttc cattggcttc caaccctgct tggctttgat gccttcaggg ttggggagacctcttt cctctg gcctggggtg ctctcacacc ctgcacgatc ttgactataa taaagcttcc ctactgc 2287 20

Copying the Code The code is copied into a molecule of m. RNA inside the cell nucleus. RNA is a single stranded copy of the code in DNA. This RNA can leave the nucleus while DNA cannot. Only one strand of the DNA is copied. Eg. DNA Antisense strand = RNA polymerase copies this CCC TGC ACT TGG GAG RNA GGG ACG TGA ACC CTC Sense strand = m. RNA will be the same * CCC UGC ACU UGG GAG ………. Etc Note: RNA and DNA are slightly different. RNA has one strand instead of two AND RNA substitutes T with U. Animation of Transcription All Ages Click on ‘Copying the Code’ Then on ‘Putting it together’ 21

Your turn – copy DNA into RNA Try to work out the following: 1. The second strand of DNA (complementary strand) 2. The code in RNA after copying the 1 st DNA strand. Write your answer down and then click to check your answer. DNA: AAT CTG GGG AAC TCG TTT CGC CCC CGA TTA GAC CCC TTG AGC AAA GCG GGG GCT RNA: UUA GAC CCC UUG AGC AAA GCG GGG GCU 22

Reading the Code RNA leaves the nucleus to combine with protein machines called ribosomes. These protein machines read the code in RNA three nucleotides at a time. Every three nucleotides in RNA is known as a codon. Each codon signals for a specific amino acid building block. Ribosomes move along the RNA strand reading the codons and joining the correct amino acid building blocks together. Animation of Translation Click on ‘Reading the code’ Then ‘putting it together’ Then ‘Translation’ 23

G T F E E E G L M M SS K S KK S G S M K K G E M S G KG EE M E G M L EE E Gene The protein folds to form its working shape G FG S FG T T L L F T Put it all together L LE F T M F L E T F T G G DNA G T NUCLEUS Chromosome CELL A C T A The order of bases in DNA is a code for making proteins. The code is read in groups of three Cell machinery copies and reads the code, and joins Amino acids together to make protein AUGAGUAAAGGAGAAGAACUUUUCACUGGAUAG M S K G E E L F T G 24

What do Amino Acids look like? An amino acid is a small molecule that always has an amino group and an acid group. Click to see what these look like. Click again to see some different amino acids. The R group is the only part that differs between the 20 amino acids. Phenylalanine Cysteine Glycine Alanine Valine Amino H 3 H C H N H S H H CH 3 C H H R C C O H H O Acid 25

Your turn Read your RNA: UUA GAC CCC UUG AGC AAA GCG GGG GCU 1. Use the code wheel below to work out the amino acids (building blocks) needed to start making your protein. The code is read from the centre outwards. For example, UUA is the code for adding Leucine. Click to check your answer 1. Leucine 2. Aspartic Acid 3. Proline 2. What are the codes that tell. UGA ribosomes to STOP adding and UAA amino acids? UAG Click to check answer 4. Leucine 8. Glycine 3. Notice that there is GCG usually more than one code for. GCA a adding particular amino acid. GCC and There are 4 codes for Alanine. GCU are they? What 9. Alanine Click to check answer 26 5. Serine 6. Lysine 7. Alanine

Amino acid ldplskaga ala a arginine arg r asparagine asn n aspartic acid asp d asx b cysteine cys c glutamic acid glu e glutamine gln q glutamine or glutamic acid glx z glycine gly g histidine his h isoleucine ile i leu l lysine lys k methionine met m phenylalanine Click to check your answer alanine leucine Now use this table to convert your amino acids into their one letter representation = the primary sequence for your protein. One letter code asparagine or aspartic acid Last step Three letter code phe f proline pro p serine ser s threonine thr t tryptophan try w tyrosine tyr y valine val v 27

So, why are we so similar to a mouse? You will use the protein amylase to investigate this. By looking at the gene sequence for amylase from a number of different organisms that all have this protein. You will be exploring the molecular evolution of amylase. 28

Looking at Amylase is a protein that cuts small maltose sugar molecules off starch molecules. This is important as we need the sugar for energy Click on the starch molecule to see amylase in action STARCH AMYLASE MALTOSE STARCH 29

Comparing the amylase code Many living things on earth have the protein amylase. They need it to cut sugars off starch so they can use the sugar for energy. We can start to get a picture of how closely related living things are by comparing the code in their genes (the genetic code = their genome). You will act as code investigators. Click on the button below to compare the codes for the protein amylase in different living organisms Code investigators 30

The relationship tree below has been made by comparing the code found in the amylase gene for the rat, fruit fly, mouse, chicken and human. The more similar the organism, the less distance between them. When you see a fork in a line (split) this means that the animals have become different to each other. Use the tree to answer the following questions: Which two are more closely related? • The Fruit fly and the chicken OR • The rat and the mouse? Do you think you are more closely related to a chicken or a mouse? Explain 31

Taking it a step further… 1. Three new organisms have been added to the tree and one removed. What are they? 2. Bacteria and fungi don’t eat food like the other organisms. They are decomposers. They digest starch using amylase protein and then absorb the sugar products. How might they get the amylase to the starch? 3. Draw in a line to show where you think a chimpanzee would be on this tree. 4. Click to see another version of this tree 32