Can a gene from a bird be inserted

Can a gene from a bird be inserted into a fox’s DNA?

Genetic Engineering The process of producing altered DNA, usually by breaking a DNA molecule and inserting new genes Recombinant DNA that has been altered by genetic engineering

Restriction Enzymes u Enzymes which cut DNA at specific base sequences (called recognition sequences) u discovered in bacteria in 1950 u not used until late 1970 s (concerns over safety)

Recognition sequences are often palindromes. What’s a palindrome? A word, phrase, verse, or sentence that reads the same backward or forward. For example: A man, a plan, a canal, Panama A segment of double-stranded DNA in which the nucleotide sequence of one strand reads in reverse order to that of the complementary strand

AGCTGATTG AATTCGCGCGCAAA TCGACTAACTTAA GCGCGCGTTT

…GAGCGATTG AATTCCCGCATT… …CTCGCTAACTTAA GGGCGTAA… AATTCGCGCGCAAA… …AGCTGATTG GCGCGCGTTT… …TCGACTAACTTAA

Recombinant Virus Activity Use the Eco R 1 enzyme to cut the human gene out of its chromosome and insert it into the virus. ECO R 1 cuts at the following recognition sequence: cut GAATTC CTTAAG cut

Creating Recombinant Plasmids

Inserting Human Genes into Bacteria http: //www. abpischools. org. uk/page/modules/genome/dna 7. cfm? co. Site. Navi gation_all. Topic=1 click “How we can use genes”; scroll down to animation

Applications of Recombinant DNA (Genetic Engineering)

Transgenic Salmon

Enviropig

Knock Out Mice created when an active gene is replaced with DNA that has no functional information. Why is this done? Without the gene present, it may be possible to determine how the gene affects the organism (its function)

Seoul National University engineered the world's first cloned, fluorescent red dog 2009. Gyoengsang National University South Korea cloned a Turkish Angora house cat and made it fluorescent

Inserting Human Genes into Bacteria http: //www. abpischools. org. uk/page/modules/genome/dna 7. cf m? co. Site. Navigation_all. Topic=1

Applications of Recombinant DNA u Gene Cloning u Pharmaceuticals u Transgenic Animals u Transgenic Plants u Gene therapy u Recombinant Vaccines

Drugs Produced Using Recombinant DNA insulin u human growth hormone u interferon u factor VIII u tissue plasminogen activator (TPA) u erythropoietin u

Making a Recombinant Vaccine Gene for surface envelope protein

Transgenic Salmon

Transgenic Animals produce human proteins u increased growth (rate, size) u increased resistance to disease u increased tolerance to cold temp. u increased flavor u

Annie The First Cloned Transgenic Cow Mastitis costs U. S. dairy farmers about $1. 7 billion annually, including lost milk revenues Antibiotics are only effective in about 15 percent of cows infected USDA and University of Vermont Jan 10, 2001 Transgenic clone of a pure-bred Jersey cow Protein (lysostaphin) in milk kills the bacteria that causes animal mastitis The gene for lysostaphin- comes from a benign species of Staph. simulans-that competes with its virulent cousins.

Transgenic Salmon

Aqua. Advantage Salmon or Frankenfish? grows twice as fast as its wild relative

Aqu. Advantage salmon, 1 st genetically modified (GM) animal ever considered for commercial consumption growth-stimulating genes from Chinook salmon and ocean pout. Atlantic salmon

The FDA has deemed Aqu. Advantage flesh to be little different from farmed or “natural” salmon. Critics argue the agency has relied on possibly skewed data provided by the company itself.

Critics FDA has focused on whether or not the salmon are safe to eat or might escape and breed with wild fish. haven’t considered how GM salmon could affect public dietary habits or the fallout of a boom in fish farming. Wired

Critics: Aqu. Advantage salmon may escape and interbreed with wild salmon, potentially eradicating a majestic portion of the living world’s heritage. Genetic Pollution? GM salmon won’t interbreed since its eggs have been designed to develop into sterile females.

Enviropig

carbon and nitrogen carbon, nitrogen and phosphorus

Eutrophication Too much nitrogen from fertilizers, nutrients leads to explosive growth of algae – block light, use up oxygen, kill off aquatic life

Eutrophication waters rich in mineral and organic nutrients that promote a proliferation of plant life, especially algae, which reduces the dissolved oxygen content and often causes the extinction of other

Enviropig

Making an enviropig

Modeling Diseases The Oncomouse

Knock Out Mice created when an active gene is replaced with DNA that has no functional information. Why is this done? Without the gene present, it may be possible to determine how the gene affects the organism (its function)

Transgenic Plants

Transgenic Plants increased resistance to insects, disease u increased versatility of growing conditions (e. g. resist frost, salt, pesticides) u increased shelf-life u increased nutritional value (e. g. B carotene in rice) u edible vaccines u

Cucumber mosaic virus (CMV) CMV infected nontransgenic tomato plants CMV resistant transgenic tomato plants

Potato Vaccine Arizona State University • edible vaccine • can be stored without refrigeration • inserted a gene from the hepatitis B virus into a Potato plant which then produces the virus antigen.

Potato Vaccine - Problems Problem 1 for the hepatitis B vaccine to work, it must survive digestion before acting on the immune system. Problem 2 raw potatoes do not make an appetizing dish Problem 3 they contain relatively inconsistent vaccine doses

Solution? Genetically modified tomatoes converting them into pills

Fish Tomato Contains an antifreeze gene from Winter flounder tomato plant infected with bacteria containing recombinant plasmid (anti freeze transgene inserted into the plasmid (antifreeze gene; staphylococcal Protein A) never commercialized 1991 DNA Plant Technology submitted a field test application to the USDA seeking approval for a field test previously tested the tomato in greenhouse setting results of these tests are unknown.

The First “Frankenfood” 1994 Flavrsavr tomato approved by the FDA Feeding study – turned over to the FDA Rats refused to eat the GM tomato

Roundup-ready soybeans • Monsanto - producer of Roundup • billion-dollar product • generates about 40 percent of the company's annual revenue.

Genetic use restriction technology (GURT) terminator technology "suicide seeds" second generation seeds to be sterile Farmers are forced to purchase new seeds each year.

Iraq - Order 81 "Plant Variety Protection. " forces Iraq's commercial farmers to use registered terminator seeds (the "protected variety"). defines natural seeds as illegal (the "infringing variety imposing biological standardization accomplishes the exact opposite: It reduces biodiversity and threatens species. Iraqi farmers have been saving wheat and barley seeds since at least 4000 BC, when irrigated agriculture first emerged, and probably even to about 8000 BC, when wheat was first domesticated. Mutant Seeds for Mesopotamia 10/15/2008

Bt Corn Bacillus thuringiensis—that makes a protein toxin that destroys the functioning of guts in some insects. Bt toxin gene from the bacteria put into corn plants, thereby conferring general insect herbivore resistance to this crop (the main pest - the European corn borer).

February 24, 2004 u "Modified Seeds Found Amid Unmodified Crops. " u BIOENGINEERED FRANKENFOODS CONTAMINATING U. S. FOOD SUPPLY!

Transfer of transgenic crop toxins to aquatic ecosystems potentially widespread in the industrial Corn Belt of the U. S. Monday, September 27 th, 2010

What causes a genetic disease? As a result of this change, what is missing in someone with a genetic disease?

Which is better? Give a man a fish or Teach a man to fish

Give a man a fish and you feed him for a day. Teach a man to fish and you feed him for a lifetime. Chinese Proverb

Which is better? Give someone with a disease the protein they need or Give someone the gene for the protein they need

Gene therapy u– process of correcting or treating genetic defects by transferring normal genes to the people that lack them

Gene Therapy For Blindness http: //www. youtube. com/watch? v=d_ YJZn-ft_Q For Muscular dystrophy http: //www. youtube. com/watch? v=vfe AJxtb-F 8 For Parkinson’s Disease http: //www. youtube. com/watch? v=7 u dk. Ev. X 0 p. L 8&feature=related

How are the genes put into the body?

Vector - a virus or plasmid that carries a molecule of recombinant DNA into a cell Why aren’t bacteria used as vectors?

What’s wrong with the title?

Gene therapy 1. inset DNA into vector using recombinant DNA 2. introduce vector into appropriate host cell 3. host cells replicate (copy) the gene as they reproduce 4. host cells produce the protein

In Vivo Gene therapy

In Vitro Gene therapy

Mistakes

In the late 1990 s, researchers tested a gene therapy treatment that would restore the function of a crucial gene, gamma c, to cells of the immune system. This treatment appeared very successful, restoring immune function to most of the children who received it. But later, two of these children developed leukemia. Researchers found that the leukemia occurred because the newly transferred gamma c gene had stitched itself into the wrong place, interrupting the function of a gene that normally helps regulate the rate at which cells divide. As a result, the cells began to divide out of control, causing the blood cancer leukemia. Although doctors have treated the children successfully with chemotherapy, the fact that they developed leukemia during treatment raises another important safety-related issue that gene therapy researchers must address

Mistakes

Synthetic Chromosomes

Synthetic Chromosomes Craig Venter The world’s first synthetic life form 2010 The new organism is based on an existing bacterium that causes mastitis in goats, but at its core is an entirely synthetic genome that was constructed from chemicals in the laboratory.

Germ Line Gene Therapy

Ethical Concerns • How can “good” and “bad” uses of gene therapy be distinguished? • Who decides which traits are normal and which constitute a disability or disorder? • Will the high costs of gene therapy make it available only to the wealthy?

More Ethical Concerns • Could the widespread use of gene therapy make society less accepting of people who are different? • Should people be allowed to use gene therapy to enhance basic human traits such as height, intelligence, or athletic ability?

DNA Fingerprinting

What are fingerprints used for?

Do identical twins have the same fingerprints?

u. NO! fingerprint is determined by the interaction of an individual's genes and the environment in the uterus. u. The ultimate shape of fingerprints are believed to be influenced by nutrition, blood pressure, position in the womb and the growth rate of the fingers at the end of the first trimester.

usimilar patterns of whorls and ridges in the fingerprints of identical twins. udifferences between the fingers on any individual's hands.

Freed after 30 years in prison DNA Fingerprinting

Gel Electrophoresis http: //www. youtube. com/watch? v=PSwl. Ck_Z 02 c Negative end (-) Positive end (+)

Which suspect can be excluded?

Which child is from a previous marriage? Which child is adopted?

Is he the father of the child?

A Mix-up at the Hospital

A Paternity Case

http: //learn. genetics. utah. edu/content/labs/gel/

DNA Fingerprinting

1. ATCAGGGTCGACGAGGGCTTC 2. ATCTGGGTCGACGAGGGCTTC AGGG # of bases 14 13 12 11 10 9 8 7 6 5 Sequence 1 Sequence 2 (mutation)

Genetic Screening

Using DNA fingerprinting to Classify Organisms

1 2 3 1. Which diagram represents the production of a recombinant vaccine? 2. Which diagram represents the production of a human protein? 3. Which diagram represents gene therapy? 3 1 2 All

Hydrogen bonds Polymer, monomer Template Names of bases (AGCT) Code (where’s the info? ) Gene Transcription Translation Watson and Crick Restriction enzymes Cut and paste Biochemical catalysts Uses of gel Electrophoresis

In 1961 molecule in jellyfish that glowed bright green under ultraviolet light protein could be attached to other proteins--enabling scientists to mark proteins of their choice with a green glow. green fluorescent protein (GFP) has been used to decrypt previously invisible processes, like the spread of cancer or the development of nerve cells earning Shimomura and colleagues a Nobel Prize in 2008 Green fluorescent protein, introduced into DNA of egg via virus (2008) Scientists at the Yerkes National Primate Research Center in Atlanta are using green fluorescent protein to study Huntington's disease, which destroys nervous tissue. In 2008 the researchers infected unfertilized monkey eggs with an HIV-like virus, which changed the eggs' DNA to include the defect that causes Huntington's.

Tokyo Japan, May 27, 2009 Keio University School of Medicine skin that glows green under UV light baby monkeys came by their fluorescence "naturally"--the first time artificially introduced genes have been passed from parent to offspring in primates

Bioremediation

EPA knows of the non-toxic, bioremediation solutions that could have been used first few weeks of the BP Horizon accidental discharge that would have prevented most of the damage to marine life, environment, and public’s health since the oil well blow out. Non-toxic bioremediation solutions can still be used to thoroughly and quickly clean up the oil and the toxic chemical dispersant, and reverse the damage to the Gulf. Bioremediation technology is a fraction the cost of other cleanup methods being used and would save the U. S. government untold wasted funds. Non-toxic, first-response, bioremediation products are already on the Environmental Protection Agency’s (EPA) National Contingency Plan (NCP) list of approved products for use in cleaning up oil spills. EPA provided no valid scientific reason for withholding permits for the full and immediate implementation of thoroughly vetted and demonstrably workable, non-toxic, bioremediation remedies designed to fully detoxify and remediate both the oil and the toxic dispersant within two to four weeks.

Senator demands feds end Gulf poison spray due to 'alarming health problems' http: //www. examiner. com Louisiana Senator A. G. Crowe who is asking for public support to replace poisons with bioremediation.

The process of using naturally present microorganisms to clean up oil spills is called bioremediation. Unfortunately the process won’t work out at sea and can only be used when the oil reaches shore — which is what the coast guard and clean-up workers are currently trying to prevent. The microorganisms, even without fertilizers, will begin to chow down on the oil when it enters their natural habitat. So, with the addition of sulfate or nitrate fertilizers the microorganism multiply beyond their natural state and eat up the toxic metals invading their home at up to five times the rate that they would without assistance.

There is a side effect to this process, however — Isn’t there always? It is possible that after the microorganisms devour the massive oil spill they could introduce the heavy metals present in the spill into the food chain. Larger organisms eat them and on up the ladder until it reaches humans. So though bioremediation may be lessening the initial impact of oil spills on the surrounding waters it could be introducing that very oil spill into our diets

Tel Aviv University solution addresses the smaller naturally occurring oil-munching bacteria, grown in the lab, to clean amounts of oil left behind -- that which isn't easily removed from sand the hard-to-reach oil pockets that occur when oil mixes with sand and water. organic matter on beaches and forms a thin layer on the Gulf's precious waterways. identified a naturally occurring variety of sea-borne bacteria that digests oil. By studying the bacteria's genetic background, developing methods of growing the bacteria, and increasing their capacity to ingest the oil, the scientists have developed a solution that could clean up the residual oil that can't be removed by mechanical means.