Скачать презентацию Investigative Cases Bio QUEST Summer Workshop 2005 Joyce Скачать презентацию Investigative Cases Bio QUEST Summer Workshop 2005 Joyce

dadf2b2c7434fb5a5e6c88ac7c01da75.ppt

  • Количество слайдов: 30

Investigative Cases Bio. QUEST Summer Workshop 2005 Joyce Cadwallader Stacey Kiser Robin Greenler Ethel Investigative Cases Bio. QUEST Summer Workshop 2005 Joyce Cadwallader Stacey Kiser Robin Greenler Ethel Stanley >NY-99 flamingo CCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGGAGATTCAGCATCACTC CTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGAT TGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTCATGGACCT >NY-99 equine CCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGGAGATTCAGCATCACTC CTGCGGCGCCTTCATACACACTAAAGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGAT TGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCTTGGTCCATCGTGAGTGGTTCATGGACCT

The Rumor Author: Stacey Kiser, Lane CC bioquest. org/lifelines The Rumor Author: Stacey Kiser, Lane CC bioquest. org/lifelines "I read on the Internet that you can get Mad Cow Disease from Altoids. "

"Well, they are made in Great Britain and they do have gelatin in them. ”

What do you think this case is about? What do you already know that What do you think this case is about? What do you already know that relates to this case? What do you need to know to understand the case? How might this case be used to encourage students to use an interdisciplinary approach to problem solving?

NSF recommends that faculty: “Build into every course inquiry*, the processes of science, a NSF recommends that faculty: “Build into every course inquiry*, the processes of science, a knowledge of what practitioners do, and the excitement of cutting edge research. ” “involving the student in asking questions and finding answers” Shaping the Future: New Expectations for Undergraduate Education in Science, Mathematics, Engineering and Technology NSF, 1996. (p. 53)

Using investigative cases is one curricular approach to address these challenges. Using investigative cases is one curricular approach to address these challenges.

Cases: Definition A case study is a narrative - often with characters facing decisions Cases: Definition A case study is a narrative - often with characters facing decisions or a dilemma. A case defines a problem space that learners will investigate.

Elements in Common • All use realistically complex problems • All are multidisciplinary • Elements in Common • All use realistically complex problems • All are multidisciplinary • All ask learners to consider the events, decisions, facts

Investigative Case Based Learning: ICBL • ICBL blends two established methods : cases and Investigative Case Based Learning: ICBL • ICBL blends two established methods : cases and scientific inquiry – The cases provide a context. – Students engage in investigations related to the case. This includes lab, field, and computer activities. • Instruction is organized around the Bio. QUEST 3 Ps.

ICBL and the 3 Ps • Problem Posing – Read case and analyze – ICBL and the 3 Ps • Problem Posing – Read case and analyze – Learn more in resources – Figure out questions to investigate • Problem Solving –Develop or use methods to answer questions –Use field, lab, computer simulations to inquire • Peer Persuasion –Present results – many possible formats!

Find The Donor’s Dilemma case in the Biological Inquiry workbook. Find The Donor’s Dilemma case in the Biological Inquiry workbook.

BEDROCK http: //bioquest. org/bedrock/problem_spaces/index. php BEDROCK http: //bioquest. org/bedrock/problem_spaces/index. php

Using Bioinformatics for Researching Epidemiology http: //bioquest. org/lifelines/biotech 2003/llol_project_template. php? project_id=45 Using Bioinformatics for Researching Epidemiology http: //bioquest. org/lifelines/biotech 2003/llol_project_template. php? project_id=45

>Russia-63 CCAACCACTGTGGAGTCGCATGGAAACTACCCCACACAGATTGGGGCCACTCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAA AACTTGGAGAGTATGGAGAGGTGACGGTGGACTGTGAACCCGATCAGGGATTGACACCAATGCATACTACGTGATGACTGTCGGAACAAAGACGTTCTT GGTCCATCGTGAGTGGTTTATGGACCTCAACCTCCCCTGGAGCAGTGCCGGAAGCACTGTGTGGAGGAACAGAGAGACGTTG >Azerbaijan-67 CCAACCACTGTGGAGTCGCATGGAAACTACCCCACACAGATTGGGGCGACTCAGGGAGATTTAGCATCACTCCTGCGGCGCCTTCATACACACTAA AACTTGGAGAGTATGGAGAGGTGACGGTGGACTGTGAACCACGATCAGGGATTGACACCAATGCATACTACGTGATGACTGTCGGAACAAAGACGTTCT TGGTCCATCGTGAGTGGTTTATGGACCTCAACCTCCCCTGGAGCAGTGCCGGAAGCACTGTGTGGAGGAACAGAGAGACGTTG >Azerbaijan-70 CCAACCACTGTGGAGTCGCATGGAAACTACCCCACACAGATTGGGGCGACTCAGGGAGATTTAGCATCACTCCTGCGGCGCCTTCATACACACTAA AACTTGGAGAGTATGGAGAGGTGACGGTGGACTGTGAACCACGATCAGGGATTGACACCAATGCATACTACGTGATGACTGTCGGAACAAAGACGTTCT TGGTCCATCGTGAGTGGTTTATGGACCTCAACCTCCCCTGGAGCAGTGCCGGAAGCACTGTGTGGAGGAACAGAGAGACGTTG >India-55 CCGACTACAGTCGAATCGCATGGCATCTACTCAACACAGCAGGGCGCCACTCAAGCAGGCCGGTTCAGCATAACTCCAGCCGCGCCATCATACACTCTAA >Russia-63 CCAACCACTGTGGAGTCGCATGGAAACTACCCCACACAGATTGGGGCCACTCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAA AACTTGGAGAGTATGGAGAGGTGACGGTGGACTGTGAACCCGATCAGGGATTGACACCAATGCATACTACGTGATGACTGTCGGAACAAAGACGTTCTT GGTCCATCGTGAGTGGTTTATGGACCTCAACCTCCCCTGGAGCAGTGCCGGAAGCACTGTGTGGAGGAACAGAGAGACGTTG >Azerbaijan-67 CCAACCACTGTGGAGTCGCATGGAAACTACCCCACACAGATTGGGGCGACTCAGGGAGATTTAGCATCACTCCTGCGGCGCCTTCATACACACTAA AACTTGGAGAGTATGGAGAGGTGACGGTGGACTGTGAACCACGATCAGGGATTGACACCAATGCATACTACGTGATGACTGTCGGAACAAAGACGTTCT TGGTCCATCGTGAGTGGTTTATGGACCTCAACCTCCCCTGGAGCAGTGCCGGAAGCACTGTGTGGAGGAACAGAGAGACGTTG >Azerbaijan-70 CCAACCACTGTGGAGTCGCATGGAAACTACCCCACACAGATTGGGGCGACTCAGGGAGATTTAGCATCACTCCTGCGGCGCCTTCATACACACTAA AACTTGGAGAGTATGGAGAGGTGACGGTGGACTGTGAACCACGATCAGGGATTGACACCAATGCATACTACGTGATGACTGTCGGAACAAAGACGTTCT TGGTCCATCGTGAGTGGTTTATGGACCTCAACCTCCCCTGGAGCAGTGCCGGAAGCACTGTGTGGAGGAACAGAGAGACGTTG >India-55 CCGACTACAGTCGAATCGCATGGCATCTACTCAACACAGCAGGGCGCCACTCAAGCAGGCCGGTTCAGCATAACTCCAGCCGCGCCATCATACACTCTAA AGCTTGGGGAATATGGAGAAGTCACTGTGGACTGCGAGCCCCGCTCGGGCATAGACACAAACGCGTACTATGTGATGACAGTTGGGACGAAGACGTTTC TAGTCCACCGAGAATGGTTCATGGACCT >Israel-98 CCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAA AGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCT TGGTCCATCGTGAGTGGTTCATGGACCT >Italy-98 CCAACCACTGTGGAGTCGCATGGAAACTACTCCACACAGATTGGGGCCACTCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAA AGCTTGGAGAATATGGAGAAGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACTAATGCCTACTACGTGATGACTGTTGGAACAAAGACGTTTTT GGTCCATCGTGAGTGGTTCATGGACCT >Morocco-96 CCAACCACTGTTGAGTCTCATGGTAACTACTCCACACAGATTGGGGCCACTCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAA AGCTTGGAGAATATGGAGAAGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCCTACTACGTGATGACTGTTGGAACAAAGACGTTTTT GGTCCATCGTGAGTGGTTCATGGACCT >NY-99 flamingo CCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAA AGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCT TGGTCCATCGTGAGTGGTTCATGGACCT >NY-99 equine CCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAA AGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCT TGGTCCATCGTGAGTGGTTCATGGACCT >Romania-96 CCAACCACTGTGGAGTCGCATGGAAACTACTCCACACAGATTGGGGCCACTCAGGGAGATTCAGCATCACTCCTGCGGCGCCTTCATACACACTAA AGCTTGGAGAATATGGAGAAGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCTTACTACGTGATGACTGTTGGAACAAAGACGTTTTT GGTCCATCGTGAGTGGTTCATGGACCT >Connecticut-99 CCAACTACTGTGGAGTCGCACGGAAACTACTCCACACAGGTTGGAGCCACTCAGGGAGATTCAGCATCACTCCTGCAGCGCCTTCATACACACTAA AGCTTGGAGAATATGGAGAGGTGACAGTGGACTGTGAACCACGGTCAGGGATTGACACCAATGCATACTACGTGATGACTGTTGGAACAAAGACGTTCT TGGTCCATCGTGAGTGGTTCATGGACCT

Rooted Tree Based on Clustal W Analysis of E-protein Nucleic Acid Sequences: WNV Rooted Tree Based on Clustal W Analysis of E-protein Nucleic Acid Sequences: WNV

Warning! Case in Use Warning! Case in Use

Angela sighed as she held a copy of Derrick’s Malaise. “I’m supposed to come Angela sighed as she held a copy of Derrick’s Malaise. “I’m supposed to come up with my own problems for study in this bio course? ” she asked no one in particular. She re-read the short case.

“What caused Derrick’s malaria? ” Angela thought. The only thing Angela knew about malaria “What caused Derrick’s malaria? ” Angela thought. The only thing Angela knew about malaria was that people got it when they lived in other countries.

Angela noticed other students going to the computers or leafing through books at the Angela noticed other students going to the computers or leafing through books at the front of the room. She decided to go to a computer herself. Using Google, she looked up malaria and found the Mosquito Bytes site.

When the teacher walked by, he saw this on Angela’s screen. http: //whyfiles. org/016 When the teacher walked by, he saw this on Angela’s screen. http: //whyfiles. org/016 skeeter/malaria 2. html

Do you think Angela is a good student? How could we help her? Student Do you think Angela is a good student? How could we help her? Student Notes for Using Cases http: //serc. carleton. edu/files/introgeo/icbl/Case. User. Notes. doc

Implementation and Developing Assessment Strategies http: //serc. carleton. edu/introgeo/icbl/index. html Implementation and Developing Assessment Strategies http: //serc. carleton. edu/introgeo/icbl/index. html

Finding Cases Microbes Count! 2003. ASM Press Biological Inquiry: A Workbook of Investigative Cases. Finding Cases Microbes Count! 2003. ASM Press Biological Inquiry: A Workbook of Investigative Cases. 2005. Benjamin Cummings

Finding Cases http: //bioquest. org/lifelines/index. html Finding Cases http: //bioquest. org/lifelines/index. html

Finding Cases http: //ublib. buffalo. edu/libraries/projects/case. html Finding Cases http: //ublib. buffalo. edu/libraries/projects/case. html

Finding Cases https: //www. mis 4. udel. edu/Pbl/ Finding Cases https: //www. mis 4. udel. edu/Pbl/

Photo credits for opening page http: //www. foothill. fhda. edu/bio/programs/bioinfo/images/micro 1. jpg Bioinformatics program Photo credits for opening page http: //www. foothill. fhda. edu/bio/programs/bioinfo/images/micro 1. jpg Bioinformatics program at Foothills College, CA