Скачать презентацию Инструменты и методы системной биологии Н А Колчанов Скачать презентацию Инструменты и методы системной биологии Н А Колчанов

5ecd78267c077f08d91920994fe82371.ppt

  • Количество слайдов: 60

Инструменты и методы системной биологии Н. А. Колчанов kol@bionet. nsc. ru Инструменты и методы системной биологии Н. А. Колчанов [email protected] nsc. ru

РЕВОЛЮЦИЯ В МОЛЕКУЛЯРНОЙ БИОЛОГИИ И ГЕНЕТИКЕ Расшифровка структуры двойной спирали ДНК 1953 • Рентгено-структурные РЕВОЛЮЦИЯ В МОЛЕКУЛЯРНОЙ БИОЛОГИИ И ГЕНЕТИКЕ Расшифровка структуры двойной спирали ДНК 1953 • Рентгено-структурные методы расшифровка пространственной структуры белков • Методы расшифровки аминокислотных последовательностей • Методы расшифровки нуклеотидных последовательностей • Генетическая инженерия • Генодиагностика • Трансгенез • Клонирования • Молекулярные биотехнологии • ДНК-микрочипы • Массове секвенирование геномов Расшифровка генома человека Протеомика Транскриптомика Молекулярная медицина, генотерапия Конструирование молекулярно-генетических систем с заданными свойствами 2001

 Современная биология стала производителем беспрецедентно огромных объемов экспериментальных данных. Их осмысливание невозможно без Современная биология стала производителем беспрецедентно огромных объемов экспериментальных данных. Их осмысливание невозможно без привлечения современных информационных технологий, эффективных методов анализа данных и моделирования биологических систем и процессов на различных уровнях организации живой материи: от молекулярногенетического, включая организменный и заканчивая экосистемным и биосферным. В ответ на этот вызов возникает наука, называемая информационной биологией.

АНАЛИТИЧЕСКИЕ МЕТОДЫ СОВРЕМЕННОЙ БИОЛОГИИ: ИНФОРМАЦИОННЫЙ ВЗРЫВ . . ATGCCCGGGTTTAATGCGTCAGTGACTGCACA…. . . . АНАЛИТИЧЕСКИЕ МЕТОДЫ СОВРЕМЕННОЙ БИОЛОГИИ: ИНФОРМАЦИОННЫЙ ВЗРЫВ . . ATGCCCGGGTTTAATGCGTCAGTGACTGCACA…. . . .

СИСТЕМНАЯ БИОЛОГИЯ - ОТ АНАЛИЗА К СИНТЕЗУ ЦЕЛЬ: Реконструкция знаний о системах и процессах, СИСТЕМНАЯ БИОЛОГИЯ - ОТ АНАЛИЗА К СИНТЕЗУ ЦЕЛЬ: Реконструкция знаний о системах и процессах, обеспечивающих воспроизведение КЛЕТОК и ОРГАНИЗМОВ, их функционирование и взаимодействие с окружающей средой на основе информации, закодированной в геномах. МЕТОДЫ: ИНТЕГРАТИВНЫЕ ЭКСПЕРИМЕНТАЛЬНЫЕ ПОДХОДЫ: системная транскриптомика, протеомика, метаболомика, клеточная биология. БИОИНФОРМАТИКА: компьютерная интеграция экспериментальных данных, получаемых аналитическими методами молекулярной биологии, математическое моделирование молекулярно-генетических систем и процессов.

ГЕННАЯ СЕТЬ – центральный объект системной биологии Генная сеть - группа координировано функционирующих генов, ГЕННАЯ СЕТЬ – центральный объект системной биологии Генная сеть - группа координировано функционирующих генов, обеспечивающих формирование определенного фенотипического признака организма (молекулярного, биохимического, физиологического, морфологического, поведенческого и т. д. ) Обязательные компоненты генной сети: гены, кодируемые ими РНК и белки, метаболиты, пути передачи сигналов, метаболические пути, регуляторные контуры с положительными и отрицательными обратными связями.

ИНСТРУМЕНТЫ И МЕТОДЫ СИСТЕМНОЙ БИОЛОГИИ. ИНТЕГРАТИВНЫЕ ЭКСПЕРИМЕНТАЛЬНЫЕ ПОДХОДЫ: экспрессионные ДНК-чипы. Граф взаимодействий между генами ИНСТРУМЕНТЫ И МЕТОДЫ СИСТЕМНОЙ БИОЛОГИИ. ИНТЕГРАТИВНЫЕ ЭКСПЕРИМЕНТАЛЬНЫЕ ПОДХОДЫ: экспрессионные ДНК-чипы. Граф взаимодействий между генами Время M 1 2 ··· 1 1 1 XN x M : = 1 2. 2. 2. . . 1. 2 N N M ··· . . . 2. . . M ··· N j xi концентрация i-го гена в j-й временной точке Время Гены (m. RNA) Экспериментальные данные:

ИНСТРУМЕНТЫ И МЕТОДЫ СИСТЕМНОЙ БИОЛОГИИ. ИНТЕГРАТИВНЫЕ ЭКСПЕРИМЕНТАЛЬНЫЕ ПОДХОДЫ: Граф белокбелковых взаимодействий Drosophila melanogaster (7048 ИНСТРУМЕНТЫ И МЕТОДЫ СИСТЕМНОЙ БИОЛОГИИ. ИНТЕГРАТИВНЫЕ ЭКСПЕРИМЕНТАЛЬНЫЕ ПОДХОДЫ: Граф белокбелковых взаимодействий Drosophila melanogaster (7048 белков и 4780 высоко достоверных взаимодействий) (Science, 302(5651): 1727 -1736) Белки дрозофилы, ортологичные белкам человека, имеющим важное значение при возникновении заболеваний, выделены кружками с зазубренным краем. Принадлежность белков человека к тому или иному функциональному классу, обеспечивает возможность поиска новых стратегий для терапии таких болезней как рак, сердечнососудистые заболевания или диабеты различной природы. Такие белки пригодны в качестве мишеней действия лекарственных препаратов.

ИНСТРУМЕНТЫ И МЕТОДЫ СИСТЕМНОЙ БИОЛОГИИ Современная биология стала источником огромных объемов экспериментальных данных, осмысливание ИНСТРУМЕНТЫ И МЕТОДЫ СИСТЕМНОЙ БИОЛОГИИ Современная биология стала источником огромных объемов экспериментальных данных, осмысливание которых невозможно без использования эффективных информационных технологий и методов компьютерного анализа и математического моделирования ИНТЕГРАЦИЯ КОМПЬЮТЕРНЫХ БАЗ ДАННЫХ И МОДЕЛИРОВАНИЕ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИХ СИСТЕМ И ПРОЦЕССОВ Интеграция баз данных по метаболическим путям и их генетической регуляции

ИНСТРУМЕНТЫ И МЕТОДЫ СИСТЕМНОЙ БИОЛОГИИ. TRRD - база данных регуляторных районов генов эукариот: регуляторные ИНСТРУМЕНТЫ И МЕТОДЫ СИСТЕМНОЙ БИОЛОГИИ. TRRD - база данных регуляторных районов генов эукариот: регуляторные районы гена аполипопротеина В человека. Энхансер в интроне 1 Регуляторная область в экзоне Негативный регуляторный элемент промотор Энхансер в интроне 2 Энхансер в интроне ARP-1 HNF-1 -898 -1802 -3678 +1 +120 +346 +521 +621 +1064 Негативный регуляторный элемент -898 -129 -639 +1 HNF-4 HNF-3 -125 COUP C/EBP TATA -50 -100 COUP AGGCCCGGGA GGCGCCCTTT GGACCTTTTG CAATCCTGGC GCTCT - -60 -70 -50 -80 90 C/EBP HNF-4 Композиционный элемент ИЦи. Г СО РАН, http: //www. bionet. nsc. ru/trrd/ +1

ИНСТРУМЕНТЫ И МЕТОДЫ СИСТЕМНОЙ БИОЛОГИИ: базы данных по межклеточным коммуникациям и путям передачи сигналов. ИНСТРУМЕНТЫ И МЕТОДЫ СИСТЕМНОЙ БИОЛОГИИ: базы данных по межклеточным коммуникациям и путям передачи сигналов. МАР-киназный путь передачи сигнала в ядро клетки, активируемый ростовыми факторами, контролирующий процесс КЛЕТОЧНОГО ДЕЛЕНИЯ Турнаев И. И. , ИЦи. Г СО РАН, http: //wwwmgs. bionet. nsc. ru/mgs/gnw/genenet/

ИСТОЧНИКИ ИНФОРМАЦИИ ДЛЯ РЕКОНСТРУКЦИИ ГЕННЫХ СЕТЕЙ ИНФОРМАЦИЯ ИЗ КОМПЬЮТЕРНЫХ БАЗ ДАННЫХ (ЭКСТРАКЦИЯ С ИСПОЛЬЗОВАНИЕМ ИСТОЧНИКИ ИНФОРМАЦИИ ДЛЯ РЕКОНСТРУКЦИИ ГЕННЫХ СЕТЕЙ ИНФОРМАЦИЯ ИЗ КОМПЬЮТЕРНЫХ БАЗ ДАННЫХ (ЭКСТРАКЦИЯ С ИСПОЛЬЗОВАНИЕМ СПЕЦИАЛЬНЫХ ПРОГРАММ – КОНВЕРТОРОВ) ЭКСПЕРИМЕНТАЛЬНЫЕ ДАННЫЕ, ПРЕДСТАВЛЕННЫЕ В НАУЧНЫХ ПУБЛИКАЦИЯХ (КОМПЬЮТЕРНАЯ АННОТАЦИЯ)

Компьютерная технология реконструкции генных сетей: иерархия классов Gene network components Elementary events (Relationships between Компьютерная технология реконструкции генных сетей: иерархия классов Gene network components Elementary events (Relationships between the Entities ) Elementary structures (Entities) Genes RNAs Proteins Substances Reactions Regulatory events

ГЕННАЯ СЕТЬ Примеры элементарных структур и событий, значимых для функционирования генных сетей OAS m. ГЕННАЯ СЕТЬ Примеры элементарных структур и событий, значимых для функционирования генных сетей OAS m. RNA p 48 NPY Fe++ ISGF 3 alpha Proto. IX cytoplasm FCH NPY m. RNA OAS nucleus Транскрипция ISGF 3 Трансляция Heme nucleus cytoplasm Мультимеризация cytoplasm Энзиматический синтез Объекты: IFN-beta IRF-2 IFNR-II IRF-2 IRF-1 Inactive protein Active protein Jak 1 m. RNA Gene Reaction Jak 1 -p cytoplasm Фосфорилирование nucleus IRF-2 Активация транскрипции nucleus IFN-beta Подавление транскрипции Switch on Increase - switch off - decrease

Компьютерная технология формализованного описания, конструирования и визуализации генных сетей: редактор генных сетей Gen. Net. Компьютерная технология формализованного описания, конструирования и визуализации генных сетей: редактор генных сетей Gen. Net. Edit component properties

Формализованное описание, конструирование и визуализация генных сетей: скрытые слои Gene network “Macrophage activation” Click Формализованное описание, конструирование и визуализация генных сетей: скрытые слои Gene network “Macrophage activation” Click Subscheme“Jak-Stat signal transduction payhway”

Основные типы генных сетей, описанных в базе данных Gene. Net: http: //wwwmgs. bionet. nsc. Основные типы генных сетей, описанных в базе данных Gene. Net: http: //wwwmgs. bionet. nsc. ru/mgs/gnw/genenet/ X Генные сети стрессового ответа X Генные сети гомеостаза X 0 0 t t Генные сети, контролирующие процессы роста, развития, дифференцировки, морфогенеза X X Генные сети циклических процессов X 0 0 t u(X-X 0 ) Processes determining the value of the output system parameter x 0 - NEGATIVE FEEDBACK t x u(X) Processes determining the value of the output system parameter x 0 + POSITIVE FEEDBACK x

База данных GENENET: центральный фрагмент генной сети биосинтеза холестерина в клетке (регуляция по механизму База данных GENENET: центральный фрагмент генной сети биосинтеза холестерина в клетке (регуляция по механизму отрицательной обратной связи) . … farnesyldip hosphate squalene . … SS FDFS mevalonate - cholesterol FDPS gene SS gene HMGCo. A -R + + HMG-Co. A-R gene X 0 SREBP HMG-Co. A-S gene HMGCo. A -S + X SRP + HMG-Co. A Принципиальная схема регуляторного контура с отрицательной обратной связью + u(X-X 0) pre. SREBP + - LDLR gene Acetyl Co. A + Acetoacetyl Co. A X 0 + t Процессы, определяющие величину выходного параметра системы Отрицательная обратная связь cholesterol LDLR Игнатьева Е. В. , ИЦи. Г СО РАН, http: //wwwmgs. bionet. nsc. ru/mgs/gnw/genenet/ X

ФРАГМЕНТ ГЕННОЙ СЕТИ ДИФФЕРЕНЦИРОВКИ И СОЗРЕВАНИЯ ЭРИТРОЦИТОВ (База данных GENENET) + + + Принципиальная ФРАГМЕНТ ГЕННОЙ СЕТИ ДИФФЕРЕНЦИРОВКИ И СОЗРЕВАНИЯ ЭРИТРОЦИТОВ (База данных GENENET) + + + Принципиальная схема регуляторного контура с положительной обратной связью X X 0 t u(X) X 0 Процессы, определяющие величину выходного параметра системы + Положительная обратная связь Подколодная О. А. , ИЦи. Г СО РАН, http: //wwwmgs. bionet. nsc. ru/mgs/gnw/genenet/ X

ИЕРАРХИЧЕСКАЯ ОРГАНИЗАЦИЯ ГЕННЫХ СЕТЕЙ Альтернативная репрессия и активация кассеты генов с участием транскрипционного фактора ИЕРАРХИЧЕСКАЯ ОРГАНИЗАЦИЯ ГЕННЫХ СЕТЕЙ Альтернативная репрессия и активация кассеты генов с участием транскрипционного фактора E 2 F-1 на стадиях G 1 S перехода p. RB DP-1 E 2 F-1 - сайт связывания E 2 F-1/DP-1 Подавление транскрипции DP-1 E 2 F-1 + сайт связывания E 2 F-1/DP-1 Усиление транскрипции Подколодная О. А. , Турнаев И. И. , ИЦи. Г СО РАН http: //wwwmgs. bionet. nsc. ru/mgs/gnw/genenet/

Транскрипционный фактор SF 1 - центральный регулятор генных сетей стероидогенеза надпочечники, гонады гипофиз гипоталамус Транскрипционный фактор SF 1 - центральный регулятор генных сетей стероидогенеза надпочечники, гонады гипофиз гипоталамус РЕЦЕПТОРЫ SF 1 FSHR m SF 1 DAXm, h ACTHR m, h SF 1 r GHAm, h LHR r GTHIIchs холестерин HO PRLR r SF 1 r DAXm, h LHR r GHRm, r Lhbetar, b, ho, s Sta. Rm, h, b альдостерон Дезоксикортикостерон Прогестерон Кортикостерон HO HCO OH O SF 1 r O Aльдостерон P 450 arom h, r SF 1 17 -гидроксипрогестерон HO кортизол Дегидроэпиандростерон эстрон андростендион OH OH OH O 5 -андростен-3 11 -дезоксикортизол OH O OH DAXm, h P 450 c 17 h, b, r O 17 -гидрокси -прегнонолон LHR r эстрадиол тестостерон http: //wwwmgs. bionet. nsc. ru/mgs/gnw/genenet/ Ley. ILm P 450 c 11 m, b, r MISm, h P 450 c 21 m ALD 1 m P 450 sccm, h, b, r Игнатьева Е. В. , ИЦи. Г СО РАН 3 beta. HSD h ФЕРМЕНТЫ

Генные сети – интеграторы: генная сеть регуляции уровня свободных радикалов и активация связанных с Генные сети – интеграторы: генная сеть регуляции уровня свободных радикалов и активация связанных с нею генных сетей в ходе противовоспалительного ответа организма Активные формы кислорода Цитокины Ответ на тепловой шок Антиоксида нтная защита Метаболизм железа Арест клеточного цикла Апоптоз Воспаление http: //wwwmgs. bionet. nsc. ru/mgs/gnw/genenet/, Степаненко И. Л. , ИЦи. Г СО РАН В зависимости от функционального состояния организма одна и та же генная сеть – интегратор обеспечивает комбинаторную активацию различных кассет генных сетей.

Структура центрального осциллятора генной сети циркадного ритма REV-ERBa Reva-Erba PER/CRY Per 1, 2 E-box Структура центрального осциллятора генной сети циркадного ритма REV-ERBa Reva-Erba PER/CRY Per 1, 2 E-box Cry 1, 2 E-box Rora RORa CLK/BMAL 1 E-box Bmal 1 RRE Коровая петля Стабилизирующая петля J. D. Richter, 2004, Neuron

ХАРАКТЕРИСТИКИ ЦЕНТРАЛЬНОГО И ПЕРЕФЕРИЧЕСКИХ ОСЦИЛЛЯТОРОВ, ПОЛУЧЕННЫЕ НА ОСНОВЕ ЭКСПРЕССИОННЫХ ДНК-ЧИПОВ: КОЛИЧЕСТВО ЦИКЛИРУЮЩИХ ГЕНОВ И ХАРАКТЕРИСТИКИ ЦЕНТРАЛЬНОГО И ПЕРЕФЕРИЧЕСКИХ ОСЦИЛЛЯТОРОВ, ПОЛУЧЕННЫЕ НА ОСНОВЕ ЭКСПРЕССИОННЫХ ДНК-ЧИПОВ: КОЛИЧЕСТВО ЦИКЛИРУЮЩИХ ГЕНОВ И ФАЗОВЫЕ СДВИГИ Супрахиазматическое ядро 80 -337 (0. 6 -2. 7%) Т ~ 4 -8 часов Печень 187 -575 (2. 7 -9%) F. Delaunay, TRENDS in Genetics, 2002 Сердце 462 (4. 7%) Эпифиз 38 (3. 2%) Ритмические биологические процессы

ФУНКЦИОНАЛЬНЫЕ КЛАССЫ ЦИКЛИРУЮЩИХ ТРАНСКРИПТОВ В ФИБРОБЛАСТАХ, ВЫЯВЛЕННЫЕ С ИСПОЛЬЗОВАНИЕМ ЭКСПРЕССИОННЫХ ДНК-ЧИПОВ трансляция транскриционные 1% ФУНКЦИОНАЛЬНЫЕ КЛАССЫ ЦИКЛИРУЮЩИХ ТРАНСКРИПТОВ В ФИБРОБЛАСТАХ, ВЫЯВЛЕННЫЕ С ИСПОЛЬЗОВАНИЕМ ЭКСПРЕССИОННЫХ ДНК-ЧИПОВ трансляция транскриционные 1% факторы неизвестная функция транспортер 7% 1% КЛЕТОЧНЫЙ ЦИКЛ 8% 7% транскрипция 4% каналы 4% транспорт/перенос 6% Clock белки 2% структура/цитоскелет 6% передача сигнала ферменты 6% 13% протеосомы misc 6% 1% EST's прогормоны 22% 1% белки теплового рецепторы сопряженные шока/шапероны с G-белком 4% 1% Grundschober C. , 2001, J. Biol. Chem.

ИНТЕГРАЦИЯ ГЕННЫХ СЕТЕЙ ГОМЕОСТАЗА ГЛЮКОЗНЫЙ СЕНСОР ГЛЮКОЗНЫЙ База данных Gene. Net: компьютерная реконструкция генной ИНТЕГРАЦИЯ ГЕННЫХ СЕТЕЙ ГОМЕОСТАЗА ГЛЮКОЗНЫЙ СЕНСОР ГЛЮКОЗНЫЙ База данных Gene. Net: компьютерная реконструкция генной сети регуляции продукции инсулина бета клеткой поджелудочной железы ПУТЬ СИГНАЛЬНОЙ ТРАНСДУКЦИИ ОТ РЕЦЕПТОРА ИНСУЛИНА Ядро СЕКРЕЦИЯ ИНСУЛИНА РЕГУЛЯЦИЯ ЭКСПРЕССИИ ИНСУЛИНА МЕТАБОЛИЧЕСКИЕ РЕАКЦИИ Игнатьева Е. В. , Воронич Е. С. , ИЦи. Г СО РАН Митохондрия Цитоплазма Клеточная мембрана Межклеточное пространство

РЕГУЛЯТОРНЫЕ КОНТУРЫ С ПОЛОЖИТЕЛЬНЫМИ ОБРАТНЫМИ СВЯЗЯМИ, ФУНКЦИОНИРУЮЩИЕ НА УРОВНЕ БЕТА-КЛЕТОК, КОНТРОЛИРУЮТСЯ ОТРИЦАТЕЛЬНЫМИ ОБРАТНЫМИ СВЯЗЯМИ РЕГУЛЯТОРНЫЕ КОНТУРЫ С ПОЛОЖИТЕЛЬНЫМИ ОБРАТНЫМИ СВЯЗЯМИ, ФУНКЦИОНИРУЮЩИЕ НА УРОВНЕ БЕТА-КЛЕТОК, КОНТРОЛИРУЮТСЯ ОТРИЦАТЕЛЬНЫМИ ОБРАТНЫМИ СВЯЗЯМИ ИЕРАРХИЧЕСКИ ВЫСОКОГО УРОВНЯ, ФУНКЦИОНИРУЮЩИМИ НА УРОВНЕ ОРГАНИЗМА Поступление глюкозы + _ + Уровень глюкозы в крови Бета клетка + Транспорт глюкозы в ткани о органы + Адипоцит + инсулин + +

БАЗА ДАННЫХ GENENET: ГЕННАЯ СЕТЬ АДИРОЦИТА (РЕГУЛЯЦИЯ БИОСИНТЕЗА, ЗАПАСАНИЯ И МЕТАБОЛИЗМА ЖИРОВ) Внешниние факторы БАЗА ДАННЫХ GENENET: ГЕННАЯ СЕТЬ АДИРОЦИТА (РЕГУЛЯЦИЯ БИОСИНТЕЗА, ЗАПАСАНИЯ И МЕТАБОЛИЗМА ЖИРОВ) Внешниние факторы Настройка функционирования адипоцита Секреция сигнальных веществ Биосинтез жирных кислот Глюкоза Лептин Компоненты ренинангиотензиновой системы ГОРМОНЫ: • Глюкокортикоиды • Инсулин • и т. д. ГЛАВНАЯ ФУНКЦИЯ H 2 C - OH АДИПОЦИТА: OH - C - H ЗАПАСАНИЕ H 2 C - O - P ЭНЕРГИИ В ФОРМЕ ЖИРОВ (ТРИГЛИЦЕРИДОВ) ГЛИЦЕРОЛ-3 -ФОСФАТ O H 2 C - O - C - R` + 3 (R - COOH) O R - C - O - C - H H 2 C - O - C - R`` O ЖИРНЫЕ КИСЛОТЫ ТРИАЦИЛГЛИЦЕРИД

Адипоцит: индукция экспрессии генов инсулином (база данных GENENET) ИНСУЛИН стимулирует экспрессию: FAS -синтетаза жирных Адипоцит: индукция экспрессии генов инсулином (база данных GENENET) ИНСУЛИН стимулирует экспрессию: FAS -синтетаза жирных кислот, осуществляет биосинтез насыщенных жирных кислот SCD 1 - стеароил-Ко. А-десатураза, участвует в синтезе ненасыщенных жирных кислот SCD 1 Ob (лептин), гормон, регулирующий пищевое поведение FAS ИНСУЛИН Проскура А. Л. , Игнатьева Е. В. ИЦи. Г СО РАН, http: //wwwmgs. bionet. nsc. ru/mgs/gnw/genenet / OB AGT Leptin AGT

ПУТИ ПЕРЕДАЧИ СИГНАЛА ГОРМОНА ЛЕПТИНА И МУТАЦИИ, ВЫЗЫВАЮЩИЕ НАКОПЛЕНИЕ ИЗБЫТОЧНОЙ МАССЫ ТЕЛА + Лептин ПУТИ ПЕРЕДАЧИ СИГНАЛА ГОРМОНА ЛЕПТИНА И МУТАЦИИ, ВЫЗЫВАЮЩИЕ НАКОПЛЕНИЕ ИЗБЫТОЧНОЙ МАССЫ ТЕЛА + Лептин NPY РЕЦЕПТОР ЛЕПТИНА - + POMC + PROHORMONE CONVERTASE 1 MSH + РЕЦЕПТОР MSH ГИПОТАЛАМУС + ЖИРОВАЯ КЛЕТКА + ПОТРЕБЛЕНИЕ ПИЩИ МУТАЦИИ NPY - НЕЙРОПЕПТИД Y MSH - МЕЛАНОКОРТИН POMC - ПРООПИОМЕЛАНОКОРТИН Barsh G. et al. , Genetics of body-weight regulation, Nature, 2000, N 6778

Адипоцит: индукция экспрессии генов глюкокортикоидами (база данных GENENET) ГЛЮКОКОРТИКОИДЫ стимулируют экспрессию: SCD 1 - Адипоцит: индукция экспрессии генов глюкокортикоидами (база данных GENENET) ГЛЮКОКОРТИКОИДЫ стимулируют экспрессию: SCD 1 - стеароил-Ко. Адесатураза, участвует в синтезе ненасыщенных жирных кисло ГЛЮКОКОРТИКОИДЫ Ob (лептин), гормон, регулирующий пищевое поведение SCD 1 AGT – (ангиотензиноген), предшественник ингиотензина II, регулирующего давление крови FAS OB Проскура А. Л. , Игнатьева Е. В. ИЦи. Г СО РАН, http: //wwwmgs. bionet. nsc. ru/mgs/gnw/genenet/ AGT Leptin AGT

Фрагмент генной сети адипоцита: глюкокортикоиды активируют экспрессию генов ренин-ангиотензиной системы (база данных GENENET)) ДЕКСАМЕТАЗОН Фрагмент генной сети адипоцита: глюкокортикоиды активируют экспрессию генов ренин-ангиотензиной системы (база данных GENENET)) ДЕКСАМЕТАЗОН OB CTSD REN ACE Глюкокортикоиды активируют транскрипцию гена AGT, кодирующего ангиотензиноген - предшественник ингиотензина II, повышающего артериальное давление. AGT CTSG ЦИКЛИН Д 1 ПРОЛИФЕРАЦИЯ Leptin АПФ РЕНИН Leptin АНГИОТЕНЗИН II АНГИОТЕНЗИН I КАТЕПСИН Ж АНГИОТЕНЗИНОГЕН КАТЕПСИН Д ИЦи. Г СО РАН, Проскура А. Л. , Игнатьева Е. В. , http: //wwwmgs. bionet. nsc. ru/mgs/gnw/genenet/

СЕТИ РНК-РНК ВЗАИМОДЕЙСТВИЙ: микро-РНК [Calin G. et all. , PNAS (2003)] Головной мозг Щитовидная СЕТИ РНК-РНК ВЗАИМОДЕЙСТВИЙ: микро-РНК [Calin G. et all. , PNAS (2003)] Головной мозг Щитовидная железа Легкие Печень Кишечник Костный мозг H. sapiens - эффекты ми. РНК регуляция гемопоэза; • регуляция развития мозга. Список патологий, возникающих при нарушении функционирования ми. РНК: • лейкемия; • нейробластома; • фолликулярная лимфома; • пролимфоцитарная лейкемия; • миелодиспластический синдром; • рак: кожи; легких; носоглотки; шейки матки; молочной железы; толстого кишечника; эпителия мочевыводящих путей. D. melanogaster [Chen C. et al. , Science 303, 83 (2004)]: широкий спектр действия ми. РНК • стимулирует пролиферации клеток (mi. R-bantam); • предотвращает апоптоз (mi. R-14, mi. Rbantam); • влияет на жировой метаболизм (mi. R 14). lin-4 let-7 C. elegans: • ми. РНК контролируют переход между личиночными стадиями [Chen C. et al. , Science 303, 83 (2004)]; • асимметричное расположение нейронов (Isy-6) [Miska E. et all. , Genome biology (2004)]. Минимальные оценки: в геномах млекопитающих имеется до 200 микро-РНК. Каждая микро-РНК может иметь до 100 геновмишеней. В целом сеть микро. РНКвзаимодействий может включать до 20 000 генов.

КОМПЬЮТЕРНОЕ МОДЕЛИРОВАНИЕ ДИНАМИКИ ГЕННЫХ СЕТЕЙ: ХИМИКО-КИНЕТИЧЕСКИЙ ПОДХОД Примеры формального описания элементарных процессов КОМПЬЮТЕРНОЕ МОДЕЛИРОВАНИЕ ДИНАМИКИ ГЕННЫХ СЕТЕЙ: ХИМИКО-КИНЕТИЧЕСКИЙ ПОДХОД Примеры формального описания элементарных процессов

Генные сети: решение обратной задачи • Математическая модель генной сети характеризуется набором констант c Генные сети: решение обратной задачи • Математическая модель генной сети характеризуется набором констант c 1, …, ck в системе дифференциальных уравнений. • Как правило, экспериментально измеренные значения известны только для ограниченного числа констант. • Значения остальных констант определяются численно. • Ищутся такие значения констант c 1, …, ck, которые обеспечивают максимальное соответствие между рассчитанной и экспериментально наблюдаемой динамикой генной сети по множеству переменных и множеству экспериментов одновременно. Здесь i – это номер эксперимента и j(i) – номер j-го наблюдения i-го эксперимента. Xijexp – это значение переменной генной сети, измеренной в j-ом наблюдении i-го эксперимента. Xijtheor (c 1, …, ck) - это же theor значение, вычисленное с фиксированными значениями коэффициентов c 1, …, ck Эксперимент 1 Эксперимент N 2. 50 250 X 1 2. 00 Xn 200 1. 50 1. 00 100 0. 50 50 0. 00 0 0 50 100 150 модель min 0 0. 5 эксперимент 1. 0 1. 5

РЕШЕНИЕ ОБРАТНОЙ ЗАДАЧИ ДЛЯ ГЕННОЙ СЕТИ: генетический алгоритм МУТАЦИОННЫЙ ПРОЦЕСС РЕКОМБИНАЦИИ Отбор Начальная популяция РЕШЕНИЕ ОБРАТНОЙ ЗАДАЧИ ДЛЯ ГЕННОЙ СЕТИ: генетический алгоритм МУТАЦИОННЫЙ ПРОЦЕСС РЕКОМБИНАЦИИ Отбор Начальная популяция генных сетей: не все константы c 1, …, ck известны Целевой функционал: W=1/F, где Генная сеть с оптимальными значениями коэффициентов c 1, …, ck W – приспособленность организма в определенных условиях; F – среднеквадратическое отклонение вычисленных характеристик от соответствующих им экспериментальных

База данных для решения обратной задачи: экспериментальная динамика генных сетей General information Type Name_brief База данных для решения обратной задачи: экспериментальная динамика генных сетей General information Type Name_brief Name_full Organism Cells Stage. Cell. Differentiation Organism. Status Expression. Detection. Device Reference Comments Data on dynamics Protein IL-12 Interleukin-12 Mouse – musculus Peritoneal macrophages Terminally differentiated Norm Relative protein level Nomura F. et al. , 2000 C 57 BL/6 J mice Peritoneal macrophages were preincubated with LPS for the indicated periods, then washed with HBSS twice, and then stimulated with LPS. Experimental conditions Extracellular space LPS IL-12 Сytoplasm IL-12 p 40 IL-12 p 35 Nucleus

Генная сеть активации макрофагов при действии липополисахаридов (LPS) и интерферона-γ (IFN-γ) Обратная задача генных Генная сеть активации макрофагов при действии липополисахаридов (LPS) и интерферона-γ (IFN-γ) Обратная задача генных сетей: динамика концентрации транскрипционного фактора АР-1 Сравнение экспериментальных данных (Hambleton J. , et al, 1996) и результатов расчетов модели после адаптации параметров. http: //wwwmgs. bionet. nsc. ru/mgs/gnw/genenet/

ОПТИМАЛЬНОЕ ФАРМАКОЛОГИЧЕСКОЕ УПРАВЛЕНИЕ ФУНКЦИЕЙ ГЕННЫХ СЕТЕЙ Поиск оптимального управления, нормализующего динамику генной сети биосинтеза ОПТИМАЛЬНОЕ ФАРМАКОЛОГИЧЕСКОЕ УПРАВЛЕНИЕ ФУНКЦИЕЙ ГЕННЫХ СЕТЕЙ Поиск оптимального управления, нормализующего динамику генной сети биосинтеза NO при мутации, приводящей к избытку рецептора CD 14). 35 NO (10^8 unit/cell) 30 25 20 15 10 5 0 0 5 10 15 t (hours) Mutation Norm Compensatory effect (after delivering the substance) 20 25 30

Моделирование влияния мутаций на функцию генной сети регуляции биосинтеза холестерина в клетке Моделирование отклика Моделирование влияния мутаций на функцию генной сети регуляции биосинтеза холестерина в клетке Моделирование отклика генной сети на увеличенное в 2 раза поступления ЛНП в плазму крови при мутации, уменьшающей скорость экспрессии гена ЛНП рецепторов в 2 раза 3. 2 E+04 норма мутация 4. 0 E+05 3. 0 E+05 2. 0 E+05 1. 0 E+05 часы 0. 0 E+00 [св. ЛНП рецепторы], шт/клетку 0 5 10 15 20 25 30 [св. холестерин], шт/клетку [ЛНП], шт/объем клетки 5. 0 E+05 норма мутация 3. 1 E+04 3. 0 E+04 2. 9 E+04 2. 8 E+04 2. 7 E+04 2. 6 E+04 часы 2. 5 E+04 0 Рецепторы ЛНП 1. 0 E+03 5 10 НОРМА 15 20 25 МУТАЦИЯ норма мутация 8. 0 E+02 6. 0 E+02 4. 0 E+02 2. 0 E+02 часы 0. 0 E+00 0 5 10 15 20 25 30 м. РНК ЛНП рецепторов 30

Анализ мутационного портрета генной сети регуляции биосинтеза холестерина в клетке Изменение содержания свободного холестерина Анализ мутационного портрета генной сети регуляции биосинтеза холестерина в клетке Изменение содержания свободного холестерина в клетке в зависимости от мутационного изменения констант элементарных процессов в генной сети биосинтеза холестерина 2 4 15 -20% 65 -70% 200% 3 1 (1) Константа оборота фермента SRP; (2) Константа обратной реакции димеризации SREBP 1; (3) Константа Михаэлиса-Ментен фермента ацетоацетил Ко. А тиолазы; (4) Константа оборота фермента АХАТ (ацил-Кo. A: холестерин

Анализ мутационного портрета генной сети регуляции биосинтеза холестерина в клетке ГЕННАЯ СЕТЬ С УКАЗАНИЕМ Анализ мутационного портрета генной сети регуляции биосинтеза холестерина в клетке ГЕННАЯ СЕТЬ С УКАЗАНИЕМ ЧУВСТВИТЕЛЬНОСТИ СТАЦИОНАРНОГО СОДЕРЖАНИЯ СВОБОДНОГО ХОЛЕСТЕРИНА В КЛЕТКЕ К МУТАЦИОННЫМ ИЗМЕНЕНИЯМ ПАРАМЕТРОВ - изменение скоростей данных процессов в значительной степени сказывается на стационарной концентрации холестерина, которая может меняться от 0 до более чем 200% относительно нормы; - стационарная концентрация холестерина меняется не более чем на 35% от нормы; - стационарная концентрация холестерина меняется не более чем на 25% от нормы.

ЦЕНТРАЛЬНЫЙ ФРАГМЕНТ ГЕННОЙ СЕТИ БИОСИНТЕЗА ХОЛЕСТЕРИНА В КЛЕТКЕ farnesyldiphos phate . … squalene . ЦЕНТРАЛЬНЫЙ ФРАГМЕНТ ГЕННОЙ СЕТИ БИОСИНТЕЗА ХОЛЕСТЕРИНА В КЛЕТКЕ farnesyldiphos phate . … squalene . … SS FDFS mevalonate - cholesterol FDPS gene SS gene HMGCo. A -R HMG-Co. A-R gene + + SRP + HMG-Co. A SREBP HMG-Co. A-S gene HMGCo. A -S + + pre. SREBP LDLR gene + Acetyl Co. A + + Acetoacetyl Co. A cholesterol LDLR Игнатьева Е. В. , ИЦи. Г СО РАН, http: //wwwmgs. bionet. nsc. ru/mgs/gnw/genenet/

ОПТИМАЛЬНОЕ ФАРМАКОЛОГИЧЕСКОЕ УПРАВЛЕНИЕ ФУНКЦИЕЙ ГЕННЫХ СЕТЕЙ Мишенями оптимального фармакологического управления могут быть только лимитирующие ОПТИМАЛЬНОЕ ФАРМАКОЛОГИЧЕСКОЕ УПРАВЛЕНИЕ ФУНКЦИЕЙ ГЕННЫХ СЕТЕЙ Мишенями оптимального фармакологического управления могут быть только лимитирующие звенья генной сети. Их не так много. Построение мутационного портрета генной сети – обязательный этап поиска оптимального фармакологического управления. Оптимальное управление, нормализующее критическую переменную генной сети, не должно выводить генную сеть за границы нормы по другим значимым переменным.

d. V = dt Оптимальное фармакологическое управление функцией генных сетей (V, a) N - d. V = dt Оптимальное фармакологическое управление функцией генных сетей (V, a) N - NORM V – вектор переменных; a – вектор параметров (a 1, …, ak, …, ar); , …, a N- стационарное состояние, соответствующее норме. a* k U - класс кусочно-линейных управляющих функций, описывающих изменение вектора параметров a в вектора параметров a процессе фармакологического контроля) (V, a*) V – вектор переменных; a – вектор параметров (a 1, …, a*k, …, ar); * , …, a N- стационарное состояние, соответствующее патологии. (V, a*, U) U – оптимальный контроль, нормализующий функцию генной сети за счет сдвига стационарного состояния мутантной генной сети в окрестность нормы. ak d. V = dt P - PATHOLOGY Оптимальное управление, нормализующее критическую переменную генной сети, не должно выводить генную сеть за границы нормы по другим значимым переменным.

Automatically generated computer model of cell metabolism of Escherichia coli K-12 Bipartite graph of Automatically generated computer model of cell metabolism of Escherichia coli K-12 Bipartite graph of computer dynamic model of cell metabolism, with specification to the organism Escherichia coli K-12 - 4036 dynamic variables (substrates) - 3973 processes (enzyme reactions) - participation in the process with nonzero stehiometry - participation in the process with zero stehiometry

ИСКУССТВЕННЫЕ ГЕННЫЕ СЕТИ: КОМПЬЮТЕРНЫЙ ДИЗАЙН И ЭКСПЕРИМЕНТАЛЬНОЕ КОНСТРУИРОВАНИЕ белковый мультимер Генетический элемент (g) – ИСКУССТВЕННЫЕ ГЕННЫЕ СЕТИ: КОМПЬЮТЕРНЫЙ ДИЗАЙН И ЭКСПЕРИМЕНТАЛЬНОЕ КОНСТРУИРОВАНИЕ белковый мультимер Генетический элемент (g) – элементарная структурная единица ГГС Функционирование генетического элемента - синтез белка Активность генетического элемента – скорость синтеза белка Продукт (p) – белок, кодируемый g p белок м. РНК ген g Регуляторная связь ( ) - элементарная единица искусственной генной сети, посредством которой устанавливается регулирование активности одного генетического элемента (g 2), другим генетическим элементом (g 1) g 1 g 2

ИСКУССТВЕННЫЕ ГЕННЫЕ СЕТИ: КОМПЬЮТЕРНЫЙ ДИЗАЙН И ЭКСПЕРИМЕНТАЛЬНОЕ КОНСТРУИРОВАНИЕ 14 34 23 12 В зависимости ИСКУССТВЕННЫЕ ГЕННЫЕ СЕТИ: КОМПЬЮТЕРНЫЙ ДИЗАЙН И ЭКСПЕРИМЕНТАЛЬНОЕ КОНСТРУИРОВАНИЕ 14 34 23 12 В зависимости от начальных данных эта генная сеть имеет два качественно различных режима функционирования. 41 УСТОЙЧИВЫЙ ЦИКЛ: 43 31 p 3 42 g 1 g 2 g 3 g 4 концентрации 3 Устойчивый циклический режим p 2 p 1 2 1 p 4 время 0 0 5 10 74. 8 79. 8 84. 8 Устойчивое стационарное состояние p 4 УСТОЙЧИВОЕ СТАЦИОНАРНОЕ СОСТОЯНИЕ: концентрации 6 4 p 1 2 р2, р3 0 0 5 время 10

ГЕНЕТИЧЕСКИЕ КОМПЬЮТЕРЫ: искусственная генная сеть, суммирующая четырех-разрядные двоичные числа 1010 + 110 _____ 10000 ГЕНЕТИЧЕСКИЕ КОМПЬЮТЕРЫ: искусственная генная сеть, суммирующая четырех-разрядные двоичные числа 1010 + 110 _____ 10000 1+0+1=10 1+1+0=10 0+0=00 0+1+1=10

ИНФОРМАЦИОННЫЙ ВЗРЫВ В МОЛЕКУЛЯРНОЙ БИОЛОГИИ И ГЕНЕТИКЕ Расшифрованы геномы десятков тысяч вирусов, тысяч бактерий, ИНФОРМАЦИОННЫЙ ВЗРЫВ В МОЛЕКУЛЯРНОЙ БИОЛОГИИ И ГЕНЕТИКЕ Расшифрованы геномы десятков тысяч вирусов, тысяч бактерий, геном дрожжей, геномы ряда растений и животных Расшифрованы аминокислотные последовательности сотен тысяч белков Расшифрованы пространственные структуры десятков тысяч белков

PDBSite: A Database on Protein Active Sites and Their Environment PDBSite environment Active site PDBSite: A Database on Protein Active Sites and Their Environment PDBSite environment Active site

Содержание базы данных PDBSite Фармакологические препараты (50) Каталитические центры (1300) Белок+ДНК (2700) Сайты связывания Содержание базы данных PDBSite Фармакологические препараты (50) Каталитические центры (1300) Белок+ДНК (2700) Сайты связывания Белок+РНК (2000) ~15000 сайтов Посттрансляционная модификация (100) Органические лиганды (2100) Металлы (1000) Белок+белок (1000) Неорганические лиганды (400) ИНСТИТУТ ЦИТОЛОГИИ И ГЕНЕТИКИ

Программа поиска активных сайтов в структурах белков: PDBSite. Scan Поиск сайта связывания меди в Программа поиска активных сайтов в структурах белков: PDBSite. Scan Поиск сайта связывания меди в молекуле пластоцианина (PDB ID 1 BXU). Структура пластоцианина Шаблоны сайтов (PDBSite) Зеленым цветом изображены остатки распознанного сайта в пластоцианине, синим цветом изображены остатки сайта-шаблона из базы PDBSite (ID 1 B 3 ICU). Ион меди показан оранжевым шариком. ИНСТИТУТ ЦИТОЛОГИИ И ГЕНЕТИКИ

МОЛЕКУЛЯРНЫЕ МЕХАНИЗМЫ НАРУШЕНИЯ ФУНКЦИИ МУТАНТНОГО БЕЛКА P 53, ПРИВОДЯЩИЕ К РАЗВИТИЮ РАКА Substitution. Gly МОЛЕКУЛЯРНЫЕ МЕХАНИЗМЫ НАРУШЕНИЯ ФУНКЦИИ МУТАНТНОГО БЕЛКА P 53, ПРИВОДЯЩИЕ К РАЗВИТИЮ РАКА Substitution. Gly 245 ->Cys 242 Cys 176 Zn 2+ Cys 238 His 179 Zn-binding site Normal DNA-binding

Адаптивная эволюция : мутационное ускользание вируса от иммунной системы Сайты связывания ионов в пространственной Адаптивная эволюция : мутационное ускользание вируса от иммунной системы Сайты связывания ионов в пространственной структуре гемагглютинина вируса гриппа А человека совпадают с участками адаптивной эволюции PO 4 -связывающий SO 4 -связывающий Ca-связывающий Cl-связывающий Области адаптивной эволюции выделены овалами Предложен новый механизм эволюционной защиты оболочечных белков вируса гриппа от действия антител – формирование ионных «шуб» в области антигенных детерминант, обусловленное возникновением сайтов связывания различных ионов. ИНСТИТУТ ЦИТОЛОГИИ И ГЕНЕТИКИ

Web. Pro. Analyst: программа для количественного анализа взаимосвязи структура-активность в семействах гомологичных белков http: Web. Pro. Analyst: программа для количественного анализа взаимосвязи структура-активность в семействах гомологичных белков http: //wwwmgs. bionet. nsc. ru/mgs/programs/panalyst/ Множественное выравнивание последовательностей белков Активности подвижная рамка y 1 y 2 y 3 y 4 y 5 белок 1 белок 2 белок 3 белок 4 белок 5 Поиск статистической зависимости Y = F(X) Активности белков сайт От аминокислот к их физико-химическим свойствам x 1 x 2 x 3 x 4 x 5 Физико-химическая характеристика сайтов ИНСТИТУТ ЦИТОЛОГИИ И ГЕНЕТИКИ

Количественные зависимости структура-активность в белковых семействах Предсказанная Зависимость между ингибирующей слипание тромбоцитов активностью дезинтегринов Количественные зависимости структура-активность в белковых семействах Предсказанная Зависимость между ингибирующей слипание тромбоцитов активностью дезинтегринов и зарядом и альфаспиральным моментом гидрофильности сайта 26 -30 Измеренная активность Предсказанная Зависимость между антимикробной активностью пептидов и альфаспиральным моментом гидрофобности сайта 3 -18 Измеренная активность ИНСТИТУТ ЦИТОЛОГИИ И ГЕНЕТИКИ

Предсказание видимого спектра для зрения археозавра (λmax предкового родопсина археозавра) Рисунок взят из работы Предсказание видимого спектра для зрения археозавра (λmax предкового родопсина археозавра) Рисунок взят из работы Chang et al. , Mol. Biol. Evol. 19(9): 1483– 1489. 2002 ИНСТИТУТ ЦИТОЛОГИИ И ГЕНЕТИКИ

Предсказание λmax для родопсина археозавра R=0. 97 Предсказанные λmax Остатки влияющие на сдвиг длины Предсказание λmax для родопсина археозавра R=0. 97 Предсказанные λmax Остатки влияющие на сдвиг длины волны, результаты согласуются с данными других авторов Briscoe, Mol. Biol. Evol. (2001). Экспериментальные λmax Уравнение регрессии: Y=15. 784*X 1 -467. 266*X 2 -37. 661 X 1 – Среднее значение для изоэлектрической точки (Bogard) X 2 – Момент гидрофобности (Eisenberg) λmax предсказанное : Y= 506. 7 λmax измеренное: Y= 508 ИНСТИТУТ ЦИТОЛОГИИ И ГЕНЕТИКИ

ИНСТИТУТ ЦИТОЛОГИИ И ГЕНЕТИКИ ИНСТИТУТ ЦИТОЛОГИИ И ГЕНЕТИКИ